The difficulty with PCR cloning is that enough DNA sequence must be known to synthesize the primers to bracket a target gene. Name two potential sources of DNA sequence information for a target gene.
If the gene is known and the organism from which the gene is isolated is also known,
Then the best way to get the sequence is to look for it online in online databases for genes such as one provided by NCBI for free.
If the gene is not known, then the target sequence can be sent for sequencing after purifying through manual cloning in cells.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
The difficulty with PCR cloning is that enough DNA sequence must be known to synthesize the...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
EXPLAIN each answer thoroughly. There are two common goals when using PCR to amplify DNA. A. Make lots of copies of a specific DNA sequence to use in cloning (preparative PCR) B. Detect the presence or relative amount of a specific gene under varying conditions (analytical PCR) *Remember: PCR is very similiar to DNA replication, but uses a DNA polymerase to amplify only specific parts of DNA sequence based on the sequence of the primers. 3. For which goal (A...
A protein binds a DNA sequence downstream of a promoter. This results in an increased rate of transcription of the gene. Which of the following site is likely to be attached? a. Operon b. Terminator c. Activator binding site d. Promotor The following are produced by algae To prepare the insert for the gene cloning, you need to find a proper source of the DNA fragment. PCR is one of the most common ways to get the gene that you...
Which of the following statements about Polymerase Chain Reactions is wrong? a. DNA is briefly heated to break the hydrogen bonds holding two strands together. b. Primers hybridize to sequences at opposite ends of the target sequence on the same strand. c. DNA is cooled to allow primers to form hydrogen bonds with the ends of the target sequence. d. The three steps of PCR are denaturation, annealing, and extension. e. PCR produces specific DNA fragments for cloning. f. Taq...
The direct role of the DNA denaturation step in a PCR reaction is to Group of answer choices provide the optimal temperature for the DNA polymerase used separate the two DNA strands of the template allow the primers to anneal to the DNA 2. Which of the following would be useful/necessary for an expression vector BUT not for a cloning vector? Group of answer choices origin of replication regulatory sequences antibiotic resistance gene high copy number
This sequence encodes a protein that you wish to study further by cloning the gene. The protein of interest has a molecular weight of at least 10 kDa. The sequence was sequenced by a primer walking approach, but unfortunately the correct order of the sequence traces was lost (really bad lab notebook skills). Trace 1 aacgagttaaggagccagcgtaccttcgcaccgccatacatgaattttcttggctttttctatgtggatggcaatagtctagagtcggacctgcaggcatgcaag Trace 2 cagcctgttagtaggtcttactgagtcgggcgccgaattcgagctcggtacccggggatccatgagtgggcgccagttattcgtactattgggaggtcc Trace 3 ccgggtattttgtattcaatattgaataaggaatttttcatgcagagaaaaggatgtttacggctcgagcgcactcgcacatataactgtcggcagaaacgagttaaggagc Trace 4 tactattgggaggtccaaatggttttacgggagttgcactgggcgaatgctggagctattacgattcgtttaacatttccatatcgaattctcagacgactccgaatccgggtatttt Trace 5 cctgcaggcatgcaagcttggcataggtcagttcatccagggtgatgggtgtatcgtttcaatgacccgattcggaacg Answer the following-- Determine the correct order of the sequence traces and...
You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest. After amplification, you will see if the PCR was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated. To visualize the DNA, you will stain the gel with a fluorescent dye called ethidium bromide, which...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...