Is ncRNA linked to mRNA by covalent bonds, base complementary or both? What effect does this...
Is ncRNA linked to mRNA by covalent bonds, base complementary or both? What effect does this have on the transcript?
Homework Answers
no ncRNA linked to mRNA by base complementary (hydrogen bond) like DNA double strand bind to each other, this bonding affecttranscript(mRNA) because these ncRNA like miRNA,siRNA bind complemantary to mRNA and form double stranded RNA molecule which then cleaved by RISC complex which used in gene silencing process. i.e. the bonding of ncRNA cleave the transcript or mRNA.
Add Answer to:
Is ncRNA linked to mRNA by covalent bonds, base complementary or
both? What effect does this...
what base in mRna transcript would represent the DNA templete sequence ?
what base in mRna transcript would represent the DNA templete sequence ?
Covalent and non-covalent bonds. Hydrogen bonds: what type of interaction, which atoms are involved. Covalent bonds,...
Covalent and non-covalent bonds. Hydrogen bonds: what type of interaction, which atoms are involved. Covalent bonds, hydrogen bonds, Van der Waals forces, electrostatic interactions. Polarity of water What is the maximum number of hydrogen bonds that one water molecule can have with neighboring water molecules? Hydrophobic and hydrophilic molecules. Colligative properties of water Osmosis: water flow Isotonic, hypertonic and hypotonic cells: describe Amphipathic molecules. What is the molecular structure of water? Water as a universal solvent Define and describe cohesion...
Does arginine play a role in acid/base catalysis, covalent catalysis or both? Explain your answer?
Does arginine play a role in acid/base catalysis, covalent catalysis or both? Explain your answer?
11. What effect does an insertion mutation have on the mRNA reading frame, give an example?
11. What effect does an insertion mutation have on the mRNA reading frame, give an example?
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04 02 3
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04. 2 O 3
Why is it that strong covalent bonds and wear bonds are both essential in living organisms?
Why is it that strong covalent bonds and wear bonds are both essential in living organisms?
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand...
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand c) nucleotide tRNA sequence
how many covalent bonds does each carbon have in the Lewis structure?
how many covalent bonds does each carbon have in the Lewis structure?
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04 02 3
How many covalent bonds does Sn form in most of its covalent compounds? Sn does not form covalent compounds. 04. 2 O 3
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago