Question

Below is the template strand for a small gene. Draw the coding strand, the mRNA produced,...

Below is the template strand for a small gene. Draw the coding strand, the mRNA produced, and the polypeptide. 3’-TCCGTAACC-5’
0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Below is the template strand for a small gene. Draw the coding strand, the mRNA produced,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

    You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • 2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...

    2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.

  • Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand...

    Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________

  • 4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...

    4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...

  • 3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...

    3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

  • 1. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What...

    1. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the sequence of the mRNA produced from this?                                            A) 3’ TGTCCTCTCACCTTTGUAC 5’ B) 3’ UGUCCUCUCACCUUUGUAC 5’ C) 5’ ACAGGAGAGUGGAAACAUG 3’ D) 5’ UGUCCUCUCACCUUUGUAC 3’ E) 3’ ACAGGAGAGUGGAAACAUG 5’ 2. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the amino acid sequence that the MCB gene codes for? A) MET – PHE – THR –...

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT