2. Which technique would you use to accomplish each of the following:
a. amplifying DNA
__________________________________________________________
b. a vector to carry target DNA into
bacteria _______________________________________
c. produce a double stranded cut in
DNA
_________________________________________
d. separating DNA fragments by size ____________________________________________
a. amplifying DNA :– PCR ( polymerase chain reaction)
PCR is a technique used to make numerous copies of a specific segment of DNA quickly and accurately.
b. a vector to carry target DNA into bacteria :–
Plasmid vectors are modified forms of the circular extra-chromosomal DNA molecules found in bacteria, which have been engineered to contain restriction sites and marker genes to allow the detection of bacterial cells that contain the plasmid.
c. produce a double stranded cut in DNA :–
Using Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragments at specific sequences.
d. separating DNA fragments by size :–
Gel electrophoresis is a technique used to separate DNA fragments according to their size.
2. Which technique would you use to accomplish each of the following: a. amplifying DNA __________________________________________________________...
please answer and explain each answer
(2 points). Which of the following is cut by restriction enzymes? a. Double-stranded DNA b. Double stranded RNA c. Single-stranded DNA d. Single-stranded RNA (2 points). Which of the following is cut by Dicer? a. Double-stranded DNA b. Double stranded RNA d. Single-stranded RNA c. Single-stranded DNA
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
Which of the following is not a use of restriction enzymes? A. Bacteria produce them to cut up foreign viral DNA B. Making recombinant DNA C. Cutting a vector when cloning a gene D. Replicating DNA during PCR
molecular biology
16. Histone acetyltransferases would be directly involved in which of the following? A. Formation of open chromatin B. Movement of the nucleosome C. Acetylation of lysines D. Termination of gene expression E. All of the above are true. 17. What functions are accomplished by the primosome? A. Tracking along DNA B. Tracking along DNA, separating double-stranded DNA C. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers D. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers, adding...
Which of the following components is NOT used in the technique of PCR to amplify a specific DNA sequence in a mouse genome? O Specific single-stranded DNA primers O Double-stranded genomic mouse DNA O Heat-stable DNA polymerase D DNA ligase
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
BioLoG 11. chose the order below that most closely represents the order in which the following proteins participate in DNA replication. a. helicase, single stranded binging protein, primase DNA polymerase b. single -stranded binding protein, primase DNA polymerase helicase c. primase, DNA polymerase, single- stranded binding protein, helicase d. helicase, single- stranded binding protein DNA polymerase, primase. 12. what is the function of the enzyme primase during DNA replication? a. to unwind the double helix to prime it for replication...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
Which of the following is the correct order of events in the polymerase chain reaction (PCR)? See Section 20.2 (Page 468) cooling to allow primers to attach; heating to separate double-stranded DNA; elongation of DNA strand as nucleotides are added elongation of the DNA strand as nucleotides are added; cooling to allow primers to attach; heating to separate double-stranded DNA heating to separate double-stranded DNA; cooling to allow primers to attach; elongation of DNA strand as nucleotides are added heating...