Question

True or false? The forward primer attaches to the 5 prime end of the minus(-) strand....

True or false? The forward primer attaches to the 5 prime end of the minus(-) strand.

True or false? The reverse primer attaches to the 3 prime end of the plus(+) strand.

Can you explain why as well im not fully understanding this, thank you.

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
True or false? The forward primer attaches to the 5 prime end of the minus(-) strand....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • please help im lost!!! please help me with 3,4,5 D 3. True or false? The Taq...

    please help im lost!!! please help me with 3,4,5 D 3. True or false? The Taq Polymerase used in PCR is heat-sensitive. True [Select] False D 4. The reverse primer attaches to the select) prime end of the strand. D 5. The forward primer attaches to the [Select prime end of the strand. PCR primers should: Select all that apply

  • New DNA Reverse transcriptase moves to the other strand and completes complementary (minus) strand DNA synthesis...

    New DNA Reverse transcriptase moves to the other strand and completes complementary (minus) strand DNA synthesis Continued synthesis of DNA leads to extension of the minus-strand DNA. Primer New DNA Reverse transcription of -100 nucleotides at the 5' terminus is catalyzed by reverse transcriptase Completion of a short segment of the plus strand DNA and removal of both primers Ribonuclease activity removes all the plus strand of RNA except for a small fragment used as a primer. Transfer of DNA...

  • Question 19 (1 point) Saved Forward Primer: GTG ATG CGG GTT TGT GCA GAC (5' to...

    Question 19 (1 point) Saved Forward Primer: GTG ATG CGG GTT TGT GCA GAC (5' to 3' on coding strand) Make a reverse primer from the following sequence, also from the coding strand, that is GC clamped and the Tm is within plus or minus 1 degree C (using the rule of thumb for calculating Tm we used in class). Please write the primer in its own 5' to 3' sequence, so we can send it out to be synthesized....

  • Question 19 (1 point) Forward Primer: GTG ATG CGG GTT TGT GCA GAC (5' to 3'...

    Question 19 (1 point) Forward Primer: GTG ATG CGG GTT TGT GCA GAC (5' to 3' on coding strand) Make a reverse primer from the following sequence, also from the coding strand, that is GC clamped and the Tm is within plus or minus 1 degree C (using the rule of thumb for calculating Tm we used in class). Please write the primer in its own 5' to 3' sequence, so we can send it out to be synthesized. ATC...

  • Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse...

    Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse primer with this sequence ´5-CGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA-3´

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

    To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...

  • Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the...

    Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately. 2. Degrade the RNA strand with base, leaving just the cDNA. 3. cDNA is produced, which is single-stranded and complementary to the RNA of interest. 4. Double-stranded DNA for the region of interest is produced. 5. Add two primers (one forward and one reverse)...

  • QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False...

    QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False QUESTION 2 En The +1 position identifies the location for translation to begin when bound the mRNA is bound by the ribosomal subunit. True False QUESTION 3 The small ribosomal subunit binds the mRNA transcript at a sequence that is complementary to the gene promoter in order to initiate translation. O True False QUESTION 4 The 5' cap is necessary for protection from exonuclease...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT