Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols create words, and sequences of words create languages, both Human and Computer. While sequences of nucleotides create DNA, which in turn create new sequences of nucleotides called RNA, which in turn creates sequences of amino acids called proteins, which in turn create, among other things, humans that create, among other things, computers. The quest to identify this “Source Code of Life” quickly became the focus of a great deal of science over the years, not to mention computing power. One method involves the use of certain enzymes that break the nucleotide chains at a specific chemical bond, and then analyzing the resulting fragments to determine the original structure. (The actual methods involved are in some ways harder than the problem in the Project, since you do not always know the sequence of the fragments, only their length. And in some ways much easier, since you have some idea of the count of each fragment contained in the original.)
For this Project you will use the given information and a bit of logic to find an RNA sequence. You should not have to do any outside research, but feel free to explore the topic in greater depth. If you do any external research be sure to properly cite your sources. If you work with another student(s), please include their name(s) in the write-up as well. If you use any electronic resources to help you track the possible sequences or perform calculations, name them in the report, and include sample calculations (in the case of something like a spreadsheet) or sample code (in the case of a programming language). You do not need to include the actual, executable program in the report.
Suppose that when an enzyme that breaks RNA chains after each G link is applied to a 12-link chain, the fragments obtained are AC, UG, and ACG. And when an enzyme that breaks RNA chains after a C or U link is applied, the fragments obtained are U, GU, and GAC. Can you determine the entire RNA sequence from these two sets of fragments? If not, why not? Would it help to know exactly how many of each fragment you have?
Total chain length =12
Enzymes used =2
Fragments obtained = 3 +3 =6
Enzyme treatment 1, Breaking after G =AC, UG, ACG
The entire sequence contains only 2 G's and AC must be the last fragment of the sequence after being cut after a G.
Confirm sequence : _ _ _ _ _ _ _ _ _ GAC.
This sequence GAC should follow either U or AC.
Assumption sequence 1: _ _ _ _ _ _ _ _ UGAC (or)
Assimption sequence 2: _ _ _ _ _ _ _ACGAC
The fragment UG and ACG can be anywhere within the first 10 bases.
Enzyme treatment 2, Breaking after U/C=U, GU, GAC
The fragment U must be the first fragment of the sequence after being after a U. We also have a fragment UG from enzyme treatment 1.so the first base U should be followed by a G. And from the fragment GU from enzyme treatment 2, the third base should be U.
UGU _ _ _ _ _ _ GAC
After this we can neglect the assumption sequence 1, and confirm the assumption sequence 2
UGU _ _ _ _ ACGAC
this is the maximum interpretation we can obtain from the given data. The entire RNA sequence cannot be determined. Knowing how many of each fragment is obtained may help to some extent but the basic requirement that should be satisfied is that after treating with an enzyme, all the fragments must account to 12 bases. Only then we can align the sequence of bases.
Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols...
MAT243 Project #3
MAT 243: Discrete Math Structures Project 3 Sequencing Sequences of numbers are a useful mathematical tool for exploring transitions and trends. Sequences of symbols create words, and sequences of words create languages, both Human and Computer. While sequences of nucleotides create DNA, which in turn create new sequences of nucleotides called RNA, which in turn creates sequences of amino acids called proteins, which in turn create, among other things, humans that create, among other things, computers. The...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences should be contained in your discussion in of the product, marketing plan, and business proposition. Every important sales presentation should contain most - if not all of the presentation mix ingredients. There is a chart in this chapter that looks like a pie chart with a center - exhibit 11.5....
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
do numbers 4-8
4. Given any directory, use the Is command to display: • all files and sub-directories starting with the letter "D" (note do not list anything in any sub-directory) • its immediate sub-directories (sub-directories only, and no other ordinary files) its immediate hidden sub-directories only - take a screenshot (#3-3) that clearly shows the command and the result. 5. Assume that the following files are in the working directory: $ ls intro notesb ref2 section 1 section3 section4b...
For this assignment, we will consider a protein expressed in the liver of an African cheetah (Acinonyx jubatus). Biochemists determined that this protein is involved in the production of glycogen. In a stunning announcement, a snowboarder in Antarctica claims to have found a new species of cheetah that is able to survive freezing temperatures and a long, dark winter. The snowboarder described a slow, fat, white-furred cheetah that may be related to the African cheetah. Scientists isolated a fragment of...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
Part I— Just Bad Luck? Brrrring! Brrrring! Jane checked the caller ID on her phone. “Sam! Great!” she thought. It was always nice to get a call from her older brother. But a little twinge of worry tugged at her. It was just a couple of weeks ago that he had mentioned making an appointment with his doctor about some abdominal pain he had been having. “Hi Sam! It’s great to hear from you,” Jane answered. “Hi Jane. Well I...
QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...
A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...