Determine which organism the following 4568 bp sequence belongs to and its possible applications >seq_83979 4587...
Determine which organism the following 4568 bp sequence belongs to and its possible applications
>seq_83979 4587 bp
BP;A;C;G;T;OTHER;GATATCTATACAGTTGAAGTCGGAAGTTTACATACACTTAAGTTGGAGTCATTAAAACTCGTTTTTCAACTAC
TCCACAAATTTCTTGTTAACAAACAATAGTTTTGGCAAGTCAGTTAGGACATCTACTTTGTGCATGACACAAGTCATTTTTCCAACAATT
GTTTACAGACAGATTATTTCACTTATAATTCACTGTATCACAATTCCAGTGGGTCAGAAGTTTACATACACTAAGTCCGCGGAAGCTTGA
TATCGAATTCCCACGGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGG
AAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCC
CCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTC
ACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCGGGG
CGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCC
GCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGGTGGCTAACTAGAG
AACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCACCACCATGGAGTTTGGGCTGAGA
TGGGTGTTTCTGGTGGCTATTCTGAAGGATGTCCAGTGTGAGGTCCAGCTGCAGGAGAGCGGGGGCGGCCTGGTCCAGCCTGGCGGGTCC
CTGAAGCTGTCTTGCGCCGCTAGTGGCTTCGACTTTAGTCGATACTGGATGTCATGGGTGCGGCAGGCCCCTGGGAAAGGACTGGAGTGG
ATCGGCGAAATTAACCCAGATAGCTCCACAATCAATTACACTCCCAGCCTGAAGGACAAATTCATCATTTCCCGCGATAACGCCAAGAAT
ACTCTGTATCTGCAGATGTCAAAAGTGCGAAGCGAGGACACCGCACTGTACTATTGCGCCCGGAGAGGCTACTATGGGTCTAGTTACTGG
TTTGCATATTGGGGCCAGGGGACCACAGTCACAGTGTCAAGCGGAGGAGGAGGATCCGGAGGAGGAGGAGCTGGAGGAGGAGGATCTGAC
ATCGAGCTGACTCAGAGTCCTGCTATTATGTCCGCATCTCTGGGCGAACGCGTCACTATGACCTGTACAGCCTCCTCTAGTGTGTCAAGC
TCCTACCTGCACTGGTATCAGCAGAAGCCTGGATCTAGTCCAAAACTGTGGATCTACAGTACCTCAAACCTGGCTTCTGGAGTGCCAGCA
CGGTTCAGCGGATCCGGATCTGGGACCAGCTACTCACTGACCATTTCAAGCATGGAGGCCGAAGACGCAGCCACATACTATTGTCACCAG
TATCATAGAAGCCCCCCTACATTCGGATCCGGCACTAAGCTGGAGATCAAAAGGGCTGCAGCCGGAGGCAGCAATTCCATTATGTACTTC
AGCCACTTTGTCCCTGTGTTTCTGCCAGCAAAGCCCACTACCACACCAGCACCCCGCCCACCAACCCCTGCACCAACAATCGCTTCCCAG
CCCCTGTCTCTGAGACCCGAAGCTTGCCGCCCAGCTGCAGGGGGAGCAGTGCATACCAGGGGCCTGGACCCACAGTTTTGGGTCCTGGTG
GTCGTGGGAGGAGTGCTGGCCTGTTACTCTCTGCTGGTCACAGTGGCTTTCATCATCTTCTGGGTGCGGTCAAAGCGCAGCCGACTGCTG
CACAGCGATTATATGAACATGACCCCTAGGAGACCCGGCCCTACAAGAAAGCATTACCAGCCATATGCCCCTCCAAGGGACTTCGCCGCT
TACCGGAGCCTGGAGAGAGTCAAATTTTCTAGAAGTGCAGATGCCCCAGCTTACCAGCAGGGCCAGAATCAGCTGTATAACGAGCTGAAT
CTGGGGCGACGGGAGGAATATGACGTGCTGGATAAGAGAAGGGGGAGGGATCCCGAAATGGGAGGCAAGCCCAGACGAAAAAACCCTCAG
GAGGGCCTGTACAATGAACTGCAGAAGGACAAAATGGCAGAAGCCTACAGCGAAATTGGAATGAAGGGCGAGCGGAGAAGGGGGAAAGGA
CACGATGGGCTGTACCAGGGACTGTCCACTGCCACCAAAGACACCTATGATGCCCTGCATATGCAGGCTCTGCCCCCTCGGTGAGGCCGG
CCCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACC
ATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAA
GGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGG
CAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGC
CACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCC
CATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACG
GGGACGTGGTTTTCCCTCGAGATAATATGGCTTCAAAAGGGGAGGAACTGTTTACTGGCGTCGTGCCTATTCTGGTGGAACTGGATGGGG
ATGTCAACGGGCATAAATTCTCAGTGAGCGGAGAGGGAGAAGGGGACGCAACCTACGGCAAGCTGACACTGAAATTCATCTGCACCACAG
GGAAACTGCCCGTGCCTTGGCCAACCCTGGTCACTACCTTCTCCTACGGCGTGCAGTGTTTTTCTAGGTATCCCGACCACATGAAGCGCC
ATGATTTCTTTAAAAGTGCCATGCCTGAGGGCTACGTGCAGGAACGAACAATCTCATTCAAGGACGATGGGAATTATAAAACCAGAGCCG
AGGTGAAGTTTGAAGGAGACACACTGGTCAACAGAATCGAGCTGAAGGGCATTGACTTCAAAGAAGATGGGAATATTCTGGGACACAAGC
TGGAGTACAACTACAACTCTCATAACGTGTACATCACTGCCGATAAGCAGAAAAACGGCATTAAGGCTAACTTCAAGATCCGGCACAATA
TTGAGGACGGCAGTGTGCAGCTGGCAGATCATTACCAGCAGAACACACCTATCGGAGACGGCCCCGTCCTGCTGCCTGATAATCACTATC
TGTCTACTCAGAGTGCTCTGTCAAAGGACCCAAACGAGAAACGGGATCACATGGTGCTGCTGGAATTTGTCACTGCCGCTGGCATTACCC
ATGGGATGGACCAGGCCAAGCCACTGTCTCAGGAAGAAAGTACACTGATCGAGAGGGCTACAGCAACTATTAACTCAATCCCCATTAGCG
AAGACTACAGCGTGGCCTCCGCAGCCCTGAGCTCCGATGGACGCATCTTCACAGGCGTGAATGTCTATCACTTTACTGGAGGACCTTGCG
CTGAGCTGGTGGTCCTGGGAACTGCTGCAGCCGCTGCAGCCGGAAACCTGACCTGTATCGTGGCAATTGGGAACGAAAATCGAGGAATCC
TGAGCCCTTGCGGGCGGTGTAGACAGGTCCTGCTGGATCTGCATCCAGGAATCAAGGCAATTGTGAAAGACAGCGATGGACAGCCAACCG
CCGTCGGCATTAGGGAGCTGCTGCCATCCGGATACGTGTGGGAAGGGTGAATCGATCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTG
CCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAG
TAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGCTTTGCAAAGATGGATAA
AGTTTTAAACAGAGAGGAATCTTTTAATTGAGTGTATGTAAACTTCTGACCCACTGGGAATGTGATGAAAGAAATAAAAGCTGAAATGAA
TCATTCTCTCTACTATTATTCTGATATTTCACATTCTTAAAATAAAGTGGTGATCCTAACTGACCTAAGACAGGGAATTTTTACTAGGAT
TAAATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTATAGATATC//
Homework Answers
The base pair sequence is from Eukaryotic vector named Cloning vector pCDH-EF1-Glc-MCS-myc-CD8aWT-CD28-CD3z-IRES-copGFP as per BLASTn Search.
large number of excellent mammalian vectors are in circulation to clone eukaryotic gene for protein synthesis and study the transcription mechanism.it contains a eukaryotic replication of origin from an animal virus such as SV40 from simian virus 40. A promoter to drive the expression of foreign gene and selection marker, other eukaryotic features such as polyadenylation, transcription termination site etc.
Add Answer to:
Determine which organism the following 4568 bp sequence belongs
to and its possible applications
>seq_83979 4587...
3. Complete the following table, indicating the group to which the organism belongs and the common...
3. Complete the following table, indicating the group to which the organism belongs and the common name for the organism (or the disease it causes) for each of the organisms listed below: 2 ½ points Organism Group Common Name or Disease Ascaris megalocephala Aspergillus niger Candida albicans Fungi Entamoeba histolytica Enterobius vermicularis Mucor hiemalis Necatur americanus Penicillium chrysogenum Plasmodium falciparum Plasmodium vivax Rhizopus stolonifer Taenia pisiformis Helminths Trichinella spiralis
6. This question is based on the following description of an ecosystem: Organism A is a...
6. This question is based on the following description of an ecosystem: Organism A is a plant that performs photosynthesis. Organisms B eats Organism A; Organism C eats Organism B and Organism D eats Organism C. This is summarized in the following diagram: A B C D. The direction of the arrows indicated the organism that eats the other. Based on this example fill in the blanks with the appropriate answer. Organism ___ is a producer; Organism C...
8. In which one of the following cellular processes is DNA involved? (Select all that apply.)...
8. In which one of the following cellular processes is DNA involved? (Select all that apply.) DNA replication transcription translation transcription and translation 10. Dogs have lots of fur that they need to keep warm during winter months. However, this makes them prone to overheating during summer months. Luckily, dogs are commonly observed "panting," which is a method used by dogs to exchange hot air for cool air thereby decreasing their temperature. What qualification life would BEST explain this? reproduction...
The Eastern Grey Kangaroo belongs to all of the following taxa. Assuming you had access to...
The Eastern Grey Kangaroo belongs to all of the following taxa. Assuming you had access to textbooks or other scientific literature, knowing which of the following should provide you with the greatest amount of detailed information about this organism? phylum Chordata order Diprotondontia class Mammalia family Macropodidae genus Macropus
the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus poin...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
QUESTION 31 You have a DNA sequence of 1600 bp. To characterize it, you decide to...
QUESTION 31 You have a DNA sequence of 1600 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1200 bp, respectively. After using the second enzyme, you recover 700-bp and 900-bp fragments. After treatment with both enzymes, fragments were 300, 400, and 900 bp. Which is the correct map? O -400/--900----/300 --- -300-/--400--/--900---- O-900 ------/400--/3-- -400-/300----900--- -400-/-100/--300--/900 QUESTION 32 Which of the...
ruin the following table to describe the effect incubating an organism above or below its optimal...
ruin the following table to describe the effect incubating an organism above or below its optimal growth temperature has on molecules required for survival? Structure Below the optimal Temperature Above the optimal temperature Enzymes Membranes 5. Design an experiment which would allow you to determine whether an organism isolated at room temperature (around 20 °C) was a psychrotroph or a mesophile. Make sure your answer predicts where you would expect to see growth for each type of organism, and how...
8. In which one of the following cellular processes is DNA involved? (Select all that apply.) DNA replication transcription translation transcription and translation 10. Dogs have lots of fur that they need to keep warm during winter months. However, this makes them prone to overheating during summer months. Luckily, dogs are commonly observed "panting," which is a method used by dogs to exchange hot air for cool air thereby decreasing their temperature. What qualification life would BEST explain this? reproduction...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
QUESTION 31 You have a DNA sequence of 1600 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1200 bp, respectively. After using the second enzyme, you recover 700-bp and 900-bp fragments. After treatment with both enzymes, fragments were 300, 400, and 900 bp. Which is the correct map? O -400/--900----/300 --- -300-/--400--/--900---- O-900 ------/400--/3-- -400-/300----900--- -400-/-100/--300--/900 QUESTION 32 Which of the...
ruin the following table to describe the effect incubating an organism above or below its optimal growth temperature has on molecules required for survival? Structure Below the optimal Temperature Above the optimal temperature Enzymes Membranes 5. Design an experiment which would allow you to determine whether an organism isolated at room temperature (around 20 °C) was a psychrotroph or a mesophile. Make sure your answer predicts where you would expect to see growth for each type of organism, and how...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago