Question

5’ctaagATGCCGATgtttaaaagACTAAAAGTTAAgtttcacagTTCAGGGCAACGGCGGTGAgtaaaa3’ 3’gattcTACGGCTAcaaattttcTGATTTTCAATTcaaagtgtcAAGTCCCGTTGCCGCCACTcatttt5’ (3) Point mutations can be transition, transversion, synonymous change, and/or non- synonymous change. What.

5’ctaagATGCCGATgtttaaaagACTAAAAGTTAAgtttcacagTTCAGGGCAACGGCGGTGAgtaaaa3’

3’gattcTACGGCTAcaaattttcTGATTTTCAATTcaaagtgtcAAGTCCCGTTGCCGCCACTcatttt5’

(3) Point mutations can be transition, transversion, synonymous change, and/or non-

synonymous change. What types do the following mutations belong to? For the

above DNA sequence (position index starts at 1 using the biologist’s notation),

(1). a mutation occurs at position 8, changing G to A. (2). a mutation occurs at

position 11, changing G to A. (3). a mutation occurs at position 15, changing t to

c. (4). a mutation occurs at position 12, changing A to C. (5). create a stop codon

by introducing a mutation, be it point mutation or indels (insertion/deletion). (10

points).

0 0
Add a comment Improve this question Transcribed image text
Answer #1

mRNA will be formed from 3' to 5' DNA,

5’ ctaagAUGCCGAUguuuaaaagACUAAAAGUUAAguuucacagUUCAGGGCAACGGCGGUGAguaaaa 3' (mRNA)

Removal of introns and joining of exons,

5’ AUG CCG AUA CUA AAA GUU AAU UCA GGG CAA CGG CGG UGA 3'

Amino acids formed after translation,

N met pro ile leu lys val asn ser gly gln arg arg STOP C

Now you have to perform mutations on this sequence,

mRNA,

3' ctaagAUGCCGAUguuuaaaagACUAAAAGUUAAguuucacagUUCAGGGCAACGGCGGUGAguaaaa 3'

1. G to A at 8th position,

AUG to AUA

First amino acid will change from met to ile

Mis sense mutation

2. G to A at 11th position,

CCG to CCA

pro will remain pro

No change

Silent mutation

3. T to C at 15th position

This is occuring in intron, which do not participate in translation

No change

Silent mutation

4. A to C at 12th position

CUA to CUC

leu will remain leu

No change

Silent mutation

5. Change C to G at 46th position

UCA to UGA

Ser to STOP

Please rate.

Add a comment
Know the answer?
Add Answer to:
5’ctaagATGCCGATgtttaaaagACTAAAAGTTAAgtttcacagTTCAGGGCAACGGCGGTGAgtaaaa3’ 3’gattcTACGGCTAcaaattttcTGATTTTCAATTcaaagtgtcAAGTCCCGTTGCCGCCACTcatttt5’ (3) Point mutations can be transition, transversion, synonymous change, and/or non- synonymous change. What.
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Exposure to various chemicals can cause DNA mutations. Sort the phrases below as transition, transversion, or...

    Exposure to various chemicals can cause DNA mutations. Sort the phrases below as transition, transversion, or insertion/deletion mutations. Note: If you answer any part of this question incorrectly, a single red X will appear indicating that you sorted one or more of the phrases incorrectly. Exposure to various chemicals can cause DNA mutations. Sort the phrases below as transition, transversion, or insertion/deletion mutations. Note: If you answer any part of this question incorrectly, a single red X will appear indicating...

  • Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...

    Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start codon is position +1. a substitution from G to T in the arginine codon of the antisense stand a substitution of a G nucleotide at position +9 in the antisense strand a transition at position +6 in the sense strand a transversion of A in the histidine codon of the antisense strand a single nucleotide deletion at position +12 in the antisense strand a...

  • Why is an insertion or deletion more likely to result in a damaging mutation than a...

    Why is an insertion or deletion more likely to result in a damaging mutation than a point mutation? 1.Point mutations only change two or three nucleotides 2.Point mutations never change the amino acid that is called for in the protein 3.Insertions/deletions change all codons that follow them, unless they are indels of 3, 6, 9, etc 4.Point mutations cannot result in a stop codon, whereas insertions and deletions can.

  • Mutations Worksheet-Dcletlon, Inserilon & Substitution

    Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...

  • #1 Mutation 1. A chromosomes has the following segments, where represents the centromere: MNOPQRST Give the...

    #1 Mutation 1. A chromosomes has the following segments, where represents the centromere: MNOPQRST Give the chromosome sequences that would result from the following mutations: a. Deletion of MN Pericentric inversion of NOP C. Inversion of RS, followed by tandem duplication of QRST b. 2. Which type(s) of chromosomal mutations: a. Increase the amount of genetic material in a particular chromosome? b. Increase the amount of genetic material in the entire genome? c. Decrease the amount of genetic material in...

  • Question 6 (1 point) The following DNA sequence 5'-TGCGATCC-3' is mutated to 5'-TGCGAGCC-3'. This is an...

    Question 6 (1 point) The following DNA sequence 5'-TGCGATCC-3' is mutated to 5'-TGCGAGCC-3'. This is an example of which type of mutation? Transversion O Tautomeric shift O Insertion Transition

  • *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...

    *Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...

  • Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

    Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

  • 1) Which of the following mutations could result in a frameshift? A) a base insertion B)...

    1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...

  • *Template Strand of DNA 3. The following shows the first portion of a DNA strand of...

    *Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT