Which enzyme would cut this strand of DNA:
GCATGGATCCCAATGC?
Enzyme Recognition
BamHI G¯GATCC
CCTAG↑G
Enzyme Recognition
EcoRI G¯AATTC
CTTAA↑G
Enzyme Recognition
HaeIII GG¯CC
CC↑GG
Enzyme Recognition
HindIII A¯AGCTT
TTCGA↑A
Enzyme Recognition
PstI CTGCA¯G
G↑ACGTC
Which enzyme would cut this strand of DNA: GCATGGATCCCAATGC? Enzyme Recognition BamHI G¯GATCC...
Which of the following restriction enzymes do(es) generate sticky ends? A) Enzyme Recognition BamHI G↓GATCC CCTAG↑G B) Enzyme Recognition EcoRI G↓AATTC CTTAA↑G C) Enzyme Recognition HaeIII GG↓CC CC↑GG D) Enzyme Recognition HindIII A↓AGCTT TTCGA↑A E) all of the above, except c
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3' 3' CCGG 5 5' AAGCTT 3 3' TTCGAA 5 5' RGGWCCY 3 3' YCCWGGR 5 Cleavage 5G AATTC 3' 3' CTTAA G 5'...
Need Part C answered only.
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3' 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3 3' CCGG 5 5' AAGCTT 3' 3' TTCGAA 5 5'RGGWCCY 3 3' YCCWGGR 5 Cleavage 5'G AATTC 3'...
Which of the following restriction endonucleases produces 3' overhangs? (position where the enzyme cuts is indicated by an arrow) A. EcoRI (5'-G↓AATTC-3') B. HindIII (5'-A↓AGCTT-3') C. EcoRV (5'-GAT↓ATC-3') D. PstI (5'-CTGCA↓G-3')
The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...
ng Learning The following table shows where different restriction endonu abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine cleases (restriction enzymes) cleave DNA. The Cleavage 5' G EcoRI 5 GAATTC 3 AATTC 3 5' 3 CTTAAG 5' EcoRV 5 GATATC 3 3' CTATAG 5 3' CTTAA 5 GAT ATC 3 Hae? Hindlll PpuMI5' RGGWCCY 3 3' CTA TAG 5 ?'CC GG5. 5 A...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...
Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence: Wild type Allele (T): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA Polydactyly Allele (t): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on...