Question

Which enzyme would cut this strand of DNA: GCATGGATCCCAATGC?    Enzyme    Recognition BamHI    G¯GATCC...


Which enzyme would cut this strand of DNA:
GCATGGATCCCAATGC?
  
Enzyme    Recognition
BamHI    G¯GATCC
   CCTAG↑G
  
Enzyme    Recognition
EcoRI    G¯AATTC
   CTTAA↑G
  
Enzyme    Recognition
HaeIII    GG¯CC
   CC↑GG
  
Enzyme    Recognition
HindIII    A¯AGCTT
   TTCGA↑A
  
Enzyme    Recognition
PstI    CTGCA¯G
   G↑ACGTC

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Please rate.

Add a comment
Know the answer?
Add Answer to:
Which enzyme would cut this strand of DNA: GCATGGATCCCAATGC?    Enzyme    Recognition BamHI    G¯GATCC...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Which of the following restriction enzymes do(es) generate sticky ends?                      A) Enzyme Recognition       &n

    Which of the following restriction enzymes do(es) generate sticky ends?                      A) Enzyme Recognition                      BamHI        G↓GATCC                                          CCTAG↑G                      B) Enzyme Recognition                      EcoRI          G↓AATTC                                           CTTAA↑G                      C) Enzyme Recognition                      HaeIII         GG↓CC                                           CC↑GG                      D) Enzyme Recognition                      HindIII       A↓AGCTT                                          TTCGA↑A                     E) all of the above, except c

  • The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the...

    The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3' 3' CCGG 5 5' AAGCTT 3 3' TTCGAA 5 5' RGGWCCY 3 3' YCCWGGR 5 Cleavage 5G AATTC 3' 3' CTTAA G 5'...

  • Need Part C answered only. The table shows where different restriction endonucleases (restriction enzymes) cleave DNA....

    Need Part C answered only. The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3' 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3 3' CCGG 5 5' AAGCTT 3' 3' TTCGAA 5 5'RGGWCCY 3 3' YCCWGGR 5 Cleavage 5'G AATTC 3'...

  • Which of the following restriction endonucleases produces 3' overhangs? (position where the enzyme cuts is indicated...

    Which of the following restriction endonucleases produces 3' overhangs? (position where the enzyme cuts is indicated by an arrow) A. EcoRI (5'-G↓AATTC-3') B. HindIII (5'-A↓AGCTT-3') C. EcoRV (5'-GAT↓ATC-3') D. PstI (5'-CTGCA↓G-3')

  • The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be...

    The recognition sequence for the restriction enzyme BamHI is '5-GGATCC-3' on one strand. What would be the recognition site on the complementary strand?

  • please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...

    please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...

  • ng Learning The following table shows where different restriction endonu abbreviation R represents the purines (adenine...

    ng Learning The following table shows where different restriction endonu abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine cleases (restriction enzymes) cleave DNA. The Cleavage 5' G EcoRI 5 GAATTC 3 AATTC 3 5' 3 CTTAAG 5' EcoRV 5 GATATC 3 3' CTATAG 5 3' CTTAA 5 GAT ATC 3 Hae? Hindlll PpuMI5' RGGWCCY 3 3' CTA TAG 5 ?'CC GG5. 5 A...

  • If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are t...

    If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are two possible orientations for the target DNA to insert into the plasmid. The following restriction enzymes would cut the 3.266 kb Bam HI genomic fragment containing the RecA gene once or twice or not at all. In the tables below, list the expected DNA fragment sizes for the two possible orientations. Round the DNA fragment sizes to...

  • 5. If you are digesting a large linear fragment that is 300,000 bp in length. How...

    5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...

  • Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or...

    Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence: Wild type Allele (T): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA Polydactyly Allele (t): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT