Transposable elements are found in the genomes of nearly every species. What sequence features can be used to distinguish RNA-based elements or retrotransposons from DNA based elements?
Retrotransposon
Class I TEs are copied in two stages: first, they are transcribed from DNA to RNA, and the RNA produced is then reverse transcribed to DNA. This copied DNA is then inserted back into the genome at a new position. The reverse transcription step is catalyzed by a reverse transcriptase, which is often encoded by the TE itself. The characteristics of retrotransposons are similar to retroviruses, such as HIV.
Retrotransposons are commonly grouped into three main orders:
DNA transposons
The cut-and-paste transposition mechanism of class II TEs does not involve an RNA intermediate. The transpositions are catalyzed by several transposase enzymes. Some transposases non-specifically bind to any target site in DNA, whereas others bind to specific target sequences. The transposase makes a staggered cut at the target site producing sticky ends, cuts out the DNA transposon and ligates it into the target site. A DNA polymerase fills in the resulting gaps from the sticky ends and DNA ligase closes the sugar-phosphate backbone. This results in target site duplication and the insertion sites of DNA transposons may be identified by short direct repeats (a staggered cut in the target DNA filled by DNA polymerase) followed by inverted repeats (which are important for the TE excision by transposase).
Cut-and-paste TEs may be duplicated if their transposition takes place during S phase of the cell cycle, when a donor site has already been replicated but a target site has not yet been replicated. Such duplications at the target site can result in gene duplication, which plays an important role in genomic evolution.
Transposable elements are found in the genomes of nearly every species. What sequence features can be...
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at random back into the genome. Some genomes can be composed almost entirely of Tes. What other factors determine the number of TEs in a genome
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at random back into the genome. Some genomes can be composed almost entirely of Tes. Given the above what do you predict about the relationship between the number of TEs in a genome and population size
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at random back into the genome. Some genomes can be composed almost entirely of Tes. The Tes might be harmful. what do you predict about the relationship between the number of TEs in a genome and population size
What percentage of the human genome is derived from transposable elements? a. less than 5% b. 25% c. 50% d. 75% e. nearly 100%
Complete the sentences about bacterial genomes using the words
and phrases (not all words and phrases are used).
metagenomics metagenomics 50% 50% plasmids microgenomics eukaryotic genomes insertion sequences (ISS) a single-stranded DNA molecule bacteriophage (viral) genomes 100 kilobases open reading frames (ORFS) 90% kilobase a single double-stranded DNA molecule The bacterial chromosome is In the E. coll genome, some predicted genes encode proteins with functions that have not yet been determined; these presumed genes are called The E. coli genome...
Regarding transposable elements: Question 8 Not yet answered Points out of 2.00 P Flag question Select one: a. non autonomous elements require other elements for transposition b. autonomous elements encode the function needed for movement O c. mobile genetic elements are thought to be present in all forms of life d. transposable elements are common in most genomes e. all of these answers are correct o In prokaryotic cells: Question 9 Not yet answered Points out of 2.00 P Flag...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
Q1) You are studying a gene called ‘Muggle’ and the partial
sequence of the encoded RNA is given below:
5’ – CGACUAGAUGCAACGUCUUACGAACUAGG-3’
Write down the sequence for the antisense strand of DNA from
which this RNA has been transcribed. Make sure to clearly indicate
your 5’ and 3’ ends of the sequence.
Can this RNA fragment be used as a probe to detect the location
of the ‘Muggle’ gene on the chromosome? Briefly explain your
answer
• Two organisms have...
Explain: a. What are the functions of helices and SSB proteins? b. What DNA sequence elements define a transcription unit and how do they relate to the RNA that is produced? c. What are the possible modes of activity of a transcription factor?
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....