Q1) You are studying a gene called ‘Muggle’ and the partial sequence of the encoded RNA is given below:
5’ – CGACUAGAUGCAACGUCUUACGAACUAGG-3’

Antisense strand,
3' GCTCATCTACGTTGCAGAATGCTTGATCC 5'
No, the given RNA cannot be used to detect the location of the gene. This is because both gene and RNA are in 5' - 3' direction. They have same sequence, except for T and U. RNA contains U and DNA contains T. Fragments with same sequences do not base pair with each other.
2. Tm = 2 (A+T) + 4 (G+C)
Organism 1 :
AT = 35%
GC = 65%
Tm = 2 (35) + 4 (65) = 330℃
Organism 2 :
AT = 20%
GC = 80%
Tm = 2 (20) + 4 (80) = 360℃
Organism 2 have higher Tm because it has more GC content. Because G and C pair with each other by 3 hydrogen bonds, a higher temperature is required to break this bond as compared to 2 hydrogen bonds of AT.
Please rate high.
Q1) You are studying a gene called ‘Muggle’ and the partial sequence of the encoded RNA...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
can you please answer all the questions
Gene therapy can best be described as the OA. repair of a defect (mutation) in a gene B. insertion of normal genes to act in place of mutant genes Oc. insertion of human genes into other organisms D. cloning of genes to produce and purify therapeutically useful proteins E. mapping of all human genetic information Donot Selection Transmission genetics A. uses recombinant DNA technology to identify, isolate, and produce millions of copies of...
25. Promoter 26. Replication 27. RNA Polymerase F. Sequence of DNA that controls gene express G. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in S phase of Interphase 28. Codon 29. Transgenic 30. Recombinant DNA 31. PCR 32. 33. 34. 35. 36. 37. 38. Plasmid Gene Therapy Gel electrophoresis DNA Profile DNA ligase GMO concern GMO benefit A. Analyzing STR patterns of blood or...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
can you guys please give me the correct answers and explain
why?
12. Which of the following statements concerning histones is INCORRECT? A. The N-terminal tails of histone proteins are frequently post-translationally modified B. Histones are small, basic proteins. C. Histones bind DNA via hydrogen bonding with bases in the major groove. D. Histone HI is not one of the core histones. E. Histones are present in eukaryotes but not bacteria. V 13. You are studying two E coli genes...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...