Question

Please help 1) Make a prediction about a gene that will be present in ETEC, but...

Please help

1) Make a prediction about a gene that will be present in ETEC, but not in other strains of E. coli (neither other pathogenic strains nor nonpathogenic strains). This may become evident based on what you read as you research your strain, or you may need to do some educated guess work. You also may end up developing and testing more than one hypothesis.

  1. What is your hypothesis?

2) Propose actual lab experiments you would do to demonstrate the utility of the PCR assay.

  1. What gene will you amplify by PCR? How will you set up the PCR?
    1. What reagents will you add?
    2. What strains will you use?
    3. What controls will you include?
    4. What cycling conditions will you use
  2. Diagram the results you would obtain after gel electrophoresis.
    1. What size will the PCR product be?
    2. What lanes should have a PCR product?
    3. What conclusions can be drawn?
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. We will look for Heat-stable enterotoxins (STs) genes in the produced by ETEC bacteria. The size of this protein is ~7KDa (70-75 amino acids = 210- 225 bp DNA)

2. The detection of pathogenic bacteria can be done using the PCR using specific primer to STs gene.

2. The STs gene can be amplified. PCR will be set in PCR machine different reagent required in the PCR.

Reageant- Primer (forward and reverse), dNTPs, Taq Polymerase, Mg++ ions in a buffer system.

The strain (cell lysate) to be tested will be used in PCR as template.

A known pathogenic ETEC cell lysate will be used as positive control and in negative control non pathogenic bacterial will be used.

The cycling conditions will be initial denaturation at 94C for 2 min, then the 30 cycles of denaturation of 94C for 30 sec, annealing at 55C for 30sec and extenstion at 72C for 30 sec.

3.

Size will be around 210 bp

Positive control and positive test lane should have band

The conclusion is that only positive (ETEC bacteria) will show the desired band.

Add a comment
Know the answer?
Add Answer to:
Please help 1) Make a prediction about a gene that will be present in ETEC, but...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Two experiments were performed in order to confirm the Beta-glucuronidase gene from E. coli was present...

    Two experiments were performed in order to confirm the Beta-glucuronidase gene from E. coli was present in the pET28a plasmid. (Lane1) PCR was performed to amplify the Beta-glucuronidase gene and if the gene was present then a single band would appear at ~7,300 bp. However, the band appeared to drag down the gel but stopped ~7,300 bp. What would cause the PCR product to smear down the gel and does this mean that the amplification of the PCR product was...

  • amplify a 161 bp fragment of the vaca gene which is only found in H. pylori....

    amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extract the DNA, run the PCR, and run the gel elctrophoresis according to standard techniques. An image of the gel electrophoresis is below. 161 bp 500 bp 400 bp 300 bp 200 bp 100 bp The lanes on your gel contain the following: . M) Mass Ladder to estimate size 1) Positive Control using DNA from a lab...

  • Please answer both parts a and b. Please explain your answer. (The marked answers in the...

    Please answer both parts a and b. Please explain your answer. (The marked answers in the pictures are incorrect!) a) b) What are the 5 base pair primer sequences required to amplify the central region of the following template, such that the final PCR product will have a length of 20 nucleotides? 3' AGCTTGTCCAGTGGTCAGAGTCAGTAGCCGTAGG 5' Select one: O a. 5' CCAGT 3' and 5'CTACT 3' b. 5' GATGA 3' and 5' GGTCA 3' O O C.5'GAACA 3' and 5' ATGCC...

  • Please, I need help with this question. Show work to solve the whole question 1. You...

    Please, I need help with this question. Show work to solve the whole question 1. You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest.  After amplification, you will see if the PCR  was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated.  To visualize...

  • This is for an a 3 unknown I am doing in Microbiology. And I don't quite...

    This is for an a 3 unknown I am doing in Microbiology. And I don't quite understand it, if you could please help thanks A. How did you prepare the template DNA? B. Name the gene that we will be sequencing in order to identify the unknown. C. Explain why this region is considered to be the target for identification instead of sequencing the entire genome? D. What is the size (in bp) of target DNA in E. coli? B....

  • You are using PCR to amplify a 300 bp target sequence, a portion of Gene X,...

    You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...

  • 2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exp...

    2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...

  • 1. You use PCR analysis on DNA from a couple and their developing fetus to screen...

    1. You use PCR analysis on DNA from a couple and their developing fetus to screen for a genetic defect. You find that both parents have one large and two small DNA bands, while the fetus has only the large DNA band. The most likely explanation for these results is : The infant is a heterozygote and the parents are both homozygotes All three are heterozygotes Both parents are heterozygotes, the fetus is a homozygote You can not tell the...

  • 1) You have two human liver cells (A and B) and you hypothesize that the insulin...

    1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence.  You extract genomic DNA from each of the cells.  Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...

  • Please help me answer this question, appreciate it a lot. 1.A 1Kb deletion in geneA was...

    Please help me answer this question, appreciate it a lot. 1.A 1Kb deletion in geneA was found to be responsible for a human recessive genetic disease. A diagnostic PCR reaction was designed to amplify part of gene A (3Kb) flanking the deletion site. Please provide predicted PCR results for non-carrier and recessive disease. b. What happens to depth of field as you increase numerical aperture? c. To make a liter 10 X TBE buffer, you need 890 mM Tris (MW...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT