Consider the template sequence TAATCGAATGGGC. Derive the six possible protein sequences translated from it.
Consider the template sequence TAATCGAATGGGC. Derive the six possible protein sequences translated from it.
Homework Answers
Add Answer to:
Consider the template sequence TAATCGAATGGGC. Derive the six
possible protein sequences translated from it.
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’...
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.
Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this...
Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this amino acid sequence. Serine-Alanine-Proline-Aspartic acid Use the codon table to answer the question. UCA-GCG-CCC-GAU UCU-GCU-CCU-GAC CCA-GCA-UCC-GAC UCA-GUA-CCA-AAU UCC-GCA-CCA-GAC
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of...
Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of function may be encoded in a particular region of the genome. Which statement is true regarding sequence motifs? Sequence motifs are found in DNA and in corresponding RNA produced by transcription. Sequence motifs are telltale sequences of nucleotides that indicate possible function. An open reading frame (ORF) is a type of sequence motif. Sequence motifs help identify sequences that encode protein-coding genes. All of...
Which of the sequences listed below are possible flanking sequences that could be generated by a...
Which of the sequences listed below are possible flanking sequences that could be generated by a transposon insertion after the first six base pairs of the target sequence GCATAGCCTGAT? 1.GATACG 2.CGTATC 3.GCATAG 4.TAGTCC 5.GCAACG please explain and thank you
Suppose you were asked to design a program to search a protein sequence database for sequences...
Suppose you were asked to design a program to search a protein sequence database for sequences that may form a-helices and β-strands on the surface of a protein (so one side of the helix or strand is surface-exposed, and one side is buried in the protein), a. What kinds of patterns in the sequence would you search for? b. Give 15 residue-long examples of a-helix and p-strand that could be found in this position in the native structure of a...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
Consider the amino acid sequence Identify the MRNA codon sequences that would be translated into this amino acid sequence. Serine-Alanine-Proline-Aspartic acid Use the codon table to answer the question. UCA-GCG-CCC-GAU UCU-GCU-CCU-GAC CCA-GCA-UCC-GAC UCA-GUA-CCA-AAU UCC-GCA-CCA-GAC
3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Suppose you were asked to design a program to search a protein sequence database for sequences that may form a-helices and β-strands on the surface of a protein (so one side of the helix or strand is surface-exposed, and one side is buried in the protein), a. What kinds of patterns in the sequence would you search for? b. Give 15 residue-long examples of a-helix and p-strand that could be found in this position in the native structure of a...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago