Human mt DNA has 2 EcoR1 restriction sites •Honey bee mt DNA has 5 restriction sites...
Homework Answers
I believe the correct answer to be:
THere will be 2 bands in case of humans and 5 bands in case of honey bee when their mt DNA is digested with EcoR1.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
Human mt DNA has 2 EcoR1 restriction sites
•Honey bee mt DNA has 5 restriction sites...
A restriction map lists the locations of DNA sequences that are cut by a particular restriction...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that...
A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that molecule will result in how many fragments?
Hi I have a problem with number 5, it involves gel analysis results. There are 2 parts, a,b,c. For A Im sure you need to make a graph with distance in (cm) on the vertical axis and log10 bp on the hor...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
A linear piece of DNA has the following restrictions sites: You decided to set up an...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
Please I need help on questions 1-4 in great detail please Load 15 mu l of...
Please I need help on questions 1-4 in great detail please
Load 15 mu l of the following samples from the above section onto the simple Wells. Seal the wells with agarose and electrophorese until the bromophenol blue in the samples has migrated to within 2 mm of the positive electrode end of the gel. Remove the gels from the unit and stain them as described in Section IV. Measure the distance of the DNA bands (in cm) from the...
A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb...
A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb 4 kb -> 1 kb 2 kb 3 kb You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
can
someone explain throughly on how to find a-c??? thanks!!!
The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...
Hi I have a problem with number 5, it involves gel
analysis results. There are 2 parts, a,b,c. For A Im sure you need
to make a graph with distance in (cm) on the vertical axis and
log10 bp on the horitzontal. I need help figuring out where to
start and what to do. Please help!
The following question will provide practice in interpreting and analyzing gel results You obtained the DNA electrophoresis gel below. Three samples of lambda phage...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
Please I need help on questions 1-4 in great detail please
Load 15 mu l of the following samples from the above section onto the simple Wells. Seal the wells with agarose and electrophorese until the bromophenol blue in the samples has migrated to within 2 mm of the positive electrode end of the gel. Remove the gels from the unit and stain them as described in Section IV. Measure the distance of the DNA bands (in cm) from the...
A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb 4 kb -> 1 kb 2 kb 3 kb You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago