Which of the following would result in the largest number of amino acids being changed?
Select one:
a. Silent mutation
b. Missense mutation
c. Frameshift
d. Triplet repeat
Silent mutation - does not change an amino acid but in some cases can still have phenotypic effect Eg by speeding up or down protein synthesis or by affecting splicing .
Missense mutation - changes an amino acid to another amino acid .this may or may not affect protein synthesis , depending on whether the change is conservative or non conservative and what the amino acids actually does.
Frame shift mutation - deletion or insertion of number of bases that is not multiple of 3 .usually introduce premature STOP codon in addition to lots of amino acid changes
Triplet repeat - triplet repeat are site of mutation in three human heritable disorder.
So the answer is - C, frame shift.
Which of the following would result in the largest number of amino acids being changed? Select...
Which term refers to a point mutation that results in different amino acids in a particular position due to substitution of one base for another? 1) missense mutation 2) silent mutation 3) nonsense mutation 4) frameshift mutation 5) translocation mutation
A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine. A mutation changed the DNA to 3'TCG5' which would code for the amino acid serine. This is an example of which of the following? Group of answer choices A silent mutation A missense mutation A nonsense mutation A frameshift mutation None of these
1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example: “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of X-ray exposure? o A nonsense 0 B missense - nonsynomous o C missense - synomous o D silent O E polymorphism O F frameshift
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result of exposure to Oxygen free-radicals? o A nonsense O B missense 0 C silent O D polymorphism O E frameshift
2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...
2 pts Match the following mutations with the effect they would produce Que Que Que Que the effect they Frameshift mutation. (Choose] Time Running Attendo Choose 1 Hour 11M The protein will contain one differentino acid. But, depending if the new amino acid is offerent types pour vs. Every amino acid proceeding the mutation will be different, as a result, the protein will be different The protein will be shorter, if the mutation occurs early on the new protein may...