Which term refers to a point mutation that results in different amino acids in a particular...
Homework Answers
Add Answer to:
Which term refers to a point mutation that results in different
amino acids in a particular...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Mutations Worksheet-Dcletlon, Inserilon & Substitution
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Which of the following would result in the largest number of amino acids being changed? Select...
Which of the following would result in the largest number of amino acids being changed? Select one: a. Silent mutation b. Missense mutation c. Frameshift d. Triplet repeat
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an...
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
The codon CAA codes for amino acid glutamine. Write the codon(s) obtained after a point mutation...
The codon CAA codes for amino acid glutamine. Write the codon(s) obtained after a point mutation that resulted in Silent mutation Nonsense mutation Missense mutation Define a mutagen and give one example (other than radiation). Describe why UV is particularly damaging to nucleic acids. Is UV a form of ionizing or non-ionizing radiation?
A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine....
A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine. A mutation changed the DNA to 3'TCG5' which would code for the amino acid serine. This is an example of which of the following? Group of answer choices A silent mutation A missense mutation A nonsense mutation A frameshift mutation None of these
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the...
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago