Consider a standard PCR reaction. If instead of including double-stranded DNA from
a biological sample, you added mRNA molecules from a biological sample, the reaction
would… Can you please explain why the answer is not E
A. work, but would yield less product because you started off with single-stranded
template
B. A and D are correct
C. work, but would generate much shorter products
D. not work because you would also need to replace the dNTPs with NTPs for the
reaction to work
E. not work because the enzyme will not have the type of template it needs
Ans cannot be option E because Taq DNA Polymerase has an intrinsic RNA-dependent DNA polymerase activity (reverse transcriptase activity). However, this activity is very low and mRNA needs to be present in large quantity.
Amount of Product will be less .
Consider a standard PCR reaction. If instead of including double-stranded DNA from a biological sample, you ...
Suppose you start a PCR reaction with 3 copies of a double stranded DNA fragment. How many copies will be present after 4 replication cycles? a. 7 b. 64 c. 48 d. 24 e. 8
Eliminating which of the following from a PCR reaction would result in no amplification of DNA? a) template DNA b) primers c) Taq Polymerase d) dNTPs e) Eliminating any of these would result in no amplification of DNA
Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...
A PCR reaction begins with 5 double stranded segment(s) of DNA. Part A: Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles? Part B: After 30 cycles?
1) What does PCR stand for and what does it do? a. Polymerase Chain Reaction; PCR deletes DNA b. Polymerase Copying Repeats; PCR amplifies DNA c. Polymerase Copying Releats; PCR deletes DNA d. Polymerase Chain Reaction; PCR amplifies DNA 2) During gel electrophoresis, the DNA fragments are separated by ____ a. charge b. DNA fragments cannot be separated c. color d. size 3) Primers are a. double stranded DNA oligonucleotide (fragment) b. double stranded RNA oligonucleotide (fragment) c. single stranded...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
As described above, prior to a primer extension reaction, a solution containing the primer and double stranded template DNA are heated to 95 degree C and then cooled back to room temperature. Why is this step necessary Would it matter if you added the dNTPs or DNA polymerase before or after this step? Why or why not?
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...