What is the consequence of a transition mutation in double-stranded DNA?
|
A purine is replaced by another purine, or a pyrimidine is replaced by another pyrimidine. |
||
|
A base pair is lost within the DNA of a gene, which causes a reading frameshift. |
||
|
The parent, but not its offspring, will be affected by the mutation. |
||
|
A base pair is added to the DNA within a gene, which causes a reading frameshift. |
||
|
A purine is replaced by a pyrimidine, or a pyrimidine is replaced by a purine. |
The answer is 1st option - A purine is replaced by another purine, or a pyrimidine is replaced by another pyrimidine.
In transition mutation, the base of a single nucleotide of DNA is replaced with another base. In transition mutation, one base in the DNA is replaced with another base of the same class. Transition mutation is a point mutation that occurs when a purine base is replaced with another purine base or a pyrimidine base is replaced with another pyrimidine base. The four nitrogenous bases in DNA are adenine (A), guanine (G), thymine (T), and cytosine (C). The four nitrogenous bases are divided into purines and pyrimidines. Adenine (A) and guanine (G) are the two purines and the cytosine (C) and thymine (T) are the two pyrimidines. Transition mutation involves a single base substitution. Transition mutation is the most common point mutation. Transition mutation mostly occurs due to the error in DNA replication. An example of transition mutation is the substitution of a purine base adenine (A) with another purine base guanine (G) or substitution of a pyrimidine base Cytosine (C) with another pyrimidine base thymine (T)
What is the consequence of a transition mutation in double-stranded DNA? A purine is replaced by...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
1. Which of these proteins have 3' to 5' exonuclease activity? (A) DNA pol I (B) DNA pol (C) Primase (D) Topoisomerase at kind of mutation is the replacement of a purine-pyrimidine base pair with a pyrimidine- purine base pair, or vice versa? (A) transition mutation (B) insertion (C) transversion mutation (D) missense mutation 3. Whi (A) Tus proteins (B) oriC (C) Ter sites (D) Primosome 4. Which of the following does NOT involve in translesion synthesis in E. coli?...
group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with a other strand; the two strands are oriented in directions. a. purine, parallel b. purine, antiparallel c. pyrimidine, parallel d. pyrimidine, antiparallel Questions 14 and 15 refer to the following information: A disaccharide composed of arabinose and xylose gives arabinose and xylonic acid by reaction with Bry-water followed by hydrolysis. Reaction of its methyl glycoside with iodomethane under basic conditions followed by hydrolysis gives...
QUESTION 3 The codon S-AUG-3' on an mRNA encodes the amino acid methionine. What is the corresponding anticodon found on the methionine charged tRNA? 3-UAC-5 5-UAC-3 o 3-GUA-5 5'-ATG-3 QUESTION 4 Match each cause of DNA damage with the mechanism by which it can lead to mutations. Topoisomerase is unable to function properly, and when it makes A cuts in the DNA strands these are not always repaired. This leads to a loss of nucleotides and potential frameshift mutations. In...
When the structure of a DNA molecule is compared to a ladder, the uprights of the ladder are composed of sugars. phosphates. purine-pyrimidine pairs. If a DNA molecule containing the base sequence 5 CAGTTA 3 unzipped during replication, and replication that occurred in the direction away from the replication fork (to right) and proceeded in three-base sequences, what would be the FIRST three-base sequence to be formed? 5 TTA 3 5 CAG 3 3 TTA 5 3 GTC 5 5...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
1. Which repair mechanism is most likely affected if the enzyme DNA glycosylase is not functioning properly? photoreactivation repair base excision repair SOS repair double-strand break repair nucleotide excision repair 2. In bacteria and eukaryotes, a mutation is when ________. In bacteria and eukaryotes, a mutation is when ________. A.the nucleotide sequence in an mRNA molecule is directly changed B.the nucleotide sequence in a DNA molecule is directly changed C.the amino acid sequence in a protein molecule is directly changed...