5. (a) Protein
Incorrectly folded proteins may result in non functional proteins.
(b) Sequence
Incorrect protein folding may be a result of a change in amino acid sequence in the protein. Change in amino acids may alter the bonding patterns within the protein.
(c) Nucleotide
Nucleotide triplets present in mRNA encode amino acids and are referred to as codons. A change in the sequence of the nucleotide triplet may result in a change in the the amino acid.
(d) DNA
mRNA is produced from the DNA. The mRNA sequence reflects the sequence present in the DNA. Thus, a change in the mRNA sequence is a result of nucleotide changes in its corresponding DNA sequence.
5. Fill in the blanks to summarize how change, or a mutation, happens in a cell...
Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein? b) What is the name of this type of...
Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help then the order of amino acids will change in the of the polypeptide chain If the resulting codon still codes for the same amino acid, If the...
DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of mutation on HbA sequence (# of bases from beginning of sequence), nucleotide change (from which base to which base?). Describe the effect of this mutation on amino acid sequence of beta-globin polypeptide chain: effect of mutation on codon, which amino acid was changed (# amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?)...
You are studying an interesting protein in nematode worms that is 100 amino acids in length. Of particular interest is the fact that the last seven amino acids are all tryptophan (codons 94 through 100). Draw here the mRNA sequence for codons 94-100: Draw here the sequence of the DNA strand RNA polymerase used as its template (show 5' 3' polarity): You mutagenize the wild type worm. Assume for the next questions you are able to isolate both normal and...
Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...
Which type of transcriptional termination requires formation of a stem loop secondary structure in the RNA? What is the primary factor involved in the termination of RNA synthesis? Is a new nucleotide added to a growing strand of RNA at the 3′ end? DNA and associated histones compose what molecule? Be able to use a codon table to give the sequence of amino acids from an mRNA sequence. I will give you an mRNA sequence; you will indicate how many...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
question 37 and 38 please
36. Which one do you think would be more harmful. A mutation that changed the nucleotide sequence of an mRNA molecule, or a mutation that changed the nucleotide sequence of a DNA molecule? 5 points 37. All body cells have the same DNA complement yet all body cells do NOT contain the same proteins. How is this possible? 5 points 38. Consider a bacterial gene that is approximately 2100 nucleotides long. 3 Points Approximately how...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....