We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
3. What is the total number of double-stranded DNA molecules in a human haploid cell in...
For a cell that is right after DNA replication, where 2n=6 a. Is this cell haploid, diploid, or tetraploid? b. How many molecules of DNA are there? c. Are chromosomes single stranded or double stranded? d. How many chromosomes are there e. How many homologous pairs are there f. How many unique chromosomes are there g. How many sister chromatid pairs are there Thank you very much!
We all know that the DNA molecules are double-stranded in living cells. Please design a Java program to prompt the user to enter a DNA sequence and then find the complement sequence of that DNA sequence, and print out a double-stranded DNA with the complement strand right beneath the original DNA sequence. See the sample output below. Sample output: Here is the starting DNA: ACGGGAGGACGGGAAAATTACTACGGCATTAGC Here is the double-stranded DNA: ACGGGAGGACGGGAAAATTACTACGGCATTAGC TGCCCTCCTGCCCTTTTAATGATGCCGTAATCG
3. (3 points) What is the sequence of the double-stranded DNA that is determined from the following " page. You must label the ends of the double-stranded molecule. old school" Sanger sequencing gel? The top of the gel is towards the top of the ddATP ddCTP ddGTP ddTTP
Haploid yeast cells that preferentially repair double-strand breaks by homologous recombination (rather than by non-homologous end joining) are especially sensitive to agents that cause double-strand breaks in DNA. If the breaks occur in the G1 phase of the cell cycle, most cells will die; however, if the breaks occur in the G2 phase, a much higher fraction of cells survive. Why do you suppose this is?
6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...
During DNA replication, because each of the double stranded molecules of DNS consists of a single strand of old DNA (parent strand) and a single strand of new DNA (daughter strand), DNA replication is also known as: • A) Origin of replication • B) Replication bubble • C) Semi-conservative replication • D) All of the above
• In the cell, DNA is duplicated in the G1 phase S phase G2 phase Division stage Which of the following statements is true? Chromatin is more compacted in prophase than during the G2 phase The key even of Sphase is the segregation of sister chromatids • • The mitotic spindle first appears during anaphase The cell increases in size during metaphase Which of the following correctly represents the order of the phases in the cell cycle? Mitosis, S phase,...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9 nm and and is 3019228 links long If the two strands of the double-stranded DNA are separated, each chain now has a radius of 530 nm. What is the link length for single-stranded DNA?