What is the average radius of a piece of double-stranded DNA in water that has a...
What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9 nm and and is 3019228 links long
If the two strands of the double-stranded DNA are separated, each chain now has a radius of 530 nm. What is the link length for single-stranded DNA?
Homework Answers
If we are modeling dsDNA, the spheres have a 1 nm radius r0, whereas the ssDNA case has a 0.5 nm radius. Since the average distance between bases is 0.34 nm for dsDNA and 0.63 nm for ssDNA, the dsDNA sphere models 6 base pairs and the single stranded sphere models 1.5 bases.
Add Answer to:
What is the average radius of a piece of double-stranded DNA in
water that has a...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due...
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...
Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed. What is the enthalpic term favoring single stranded DNA? A. Hydrogen Bonding B. Conformational C. Base Stacking D. van der...
6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA...
6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more flexible with its persistence length (lp) estimated to be an order of magnitude lower than that for dsDNA. If a particular dsDNA sequence has a (4-63 nm): a) Estimate at what concentration of NaCl dsDNA flexibility is comparable to that of ssDNA [NaCl]- a) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of SSDNA [MgCl2]-
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two...
Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...
A number of factors influence the melting properties of a linear, double-stranded DNA molecule in a...
A number of factors influence the melting properties of a linear, double-stranded DNA molecule in a 0.25M sodium chloride solution. Considering this, explain each of the following observations: (a) The Tmincreases in proportion to the length of the molecule (b) As the concentration of sodium chloride is decreased, the Tm decreases (c) Renaturation of single strands to form double strands occurs more rapidly when the DNA concentration is increased (d) The Tm value is reduced when urea is added to...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
What is the most common form of RNA and DNA in nature? both double stranded helix...
What is the most common form of RNA and DNA in nature? both double stranded helix for RNA and DNA, DNA - A for, RNA – single-stranded, DNA – double-helix, B-form right-handed helix both double stranded helix for RNA and DNA, DNA - B form both single stranded helix for RNA and DNA
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more flexible with its persistence length (lp) estimated to be an order of magnitude lower than that for dsDNA. If a particular dsDNA sequence has a (4-63 nm): a) Estimate at what concentration of NaCl dsDNA flexibility is comparable to that of ssDNA [NaCl]- a) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of SSDNA [MgCl2]-
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago