HomeworkLib
Question

Given the dna template shown in the figure below w
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

answer: U-U-U-U-U cytoplasm

0 0
Add a comment
Know the answer?
Add Answer to:
Given the dna template shown in the figure below which of the following bases would you...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 1a. Which of the following DNA strands, the top or bottom, would serve as a template...

    1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...

  • DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....

    DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....

    Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases. In the DNA molecule, guanine binds with ____________and adenine binds with ____________ in DNA; in RNA, adenine binds with _____________ instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be _______________. For the DNA codon GAT, the amino acid that would result would be__________________. The following questions relate to chs. 3 and...

  • Question 1 Which of the following pairs is mismatched? DNA polymerase makes a molecule of DNA...

    Question 1 Which of the following pairs is mismatched? DNA polymerase makes a molecule of DNA from a DNA template O DNA ligase joins segments of DNA O Primase incorporates an RNA primer RNA polymerase makes a molecule of RNA from an RNA template O Helicase separates complementary strands of DNA

  • Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long....

    Develop 3 individual DNA strands that includes all 4 bases and are each 40 bases long. (include directionality for each strand) TT I Arial 3(1201·T·EE: 5.00 From the 3 strands that you just developed, determine the consensus sequence. (include directionality) TT T Arial 3(12pt) T. - E . ES Determine the complementary strand to your consensus sequence with correct base pairing and include directionality for each strand Highlight the strand that would be your template for transcription TTT Arial 3(12pt)...

  • Would the DNA strand indicated with an arrow in the figure below serve as a template...

    Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • 1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% ,...

    1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15% a. Is this RNA molecules single stranded or double stranded? How Cant you tell? b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA? 2.) Given the following DNA 5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3' a. What is the transcript (mRNA) sequence? b....

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT