Question

Which of these is the correct sequence of events? Group of answer choices: restriction enzyme digest->...

Which of these is the correct sequence of events?

Group of answer choices:

restriction enzyme digest-> heat inactivation->agarose gel analysis

enzyme digest->heat inactivation

heat inactivation->agarose gel analysis->restriction enzyme digest

heat inactivation->restriction enzyme digest->agarose gel analysis

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
Which of these is the correct sequence of events? Group of answer choices: restriction enzyme digest->...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...

    Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...

  • A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme...

    A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme 1 cuts the plasmid in one place while restriction enzyme 2 cuts in two places. All restriction sites are at least 1kB apart from each other. Based on this information, the resulting gel should have _____ bands for the enzyme 1 reaction, _____ bands for the enzyme 2 reaction, and _____ bands for the reaction that contains both enzymes A 1; 2; 3 B...

  • Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...

    Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?

  • Which of the following is correct order to process the growing colonies: 1. plasmid purification 2....

    Which of the following is correct order to process the growing colonies: 1. plasmid purification 2. inoculate liquid culture 3. perform agarose gel electrophoresis 4. set up restriction enzyme digest A. 1,2,3,4 B. 2,1,4,3 C.1,2,4,3

  • 3. The given figure represents the agarose gel electrophoresis results from a restriction digest experiment. Lane...

    3. The given figure represents the agarose gel electrophoresis results from a restriction digest experiment. Lane 1 is a DNA ladder (values are in kb) and Lane 2 is the DNA sample cut by a restriction enzyme. What is the size of the band C in lane 2? - 1111111 About 1.8 kb Cannot tell based on the information provided 500 bp About 2 kb © Less than 1.5 bp -

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • A. Your lab To see if you understand what you did in our lab, answer the...

    A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...

  • RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...

    RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...

  • 9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...

    9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....

  • An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products...

    An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1, 3 and 5 kb are seen. How many EcoRI sites are in the plasmid? Choose the one answer that is most correct. Group of answer choices: At least 2, At least 3, At least 5, None, At least 1, At least 4

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT