Answer:
1.
The BLAST(Basic Local Alignment Search Tool detect the local
similar areas between sequences. It is used to make comparison
between sequences of nucleotide or protein and databases of
sequence. It makes calculation of the significance of
matches.
2.max score is calculated by BLAST by calculating highest alignment
score between the sequence segment of database & query
sequence.
3. Query coverage is calculated by BLAST by calculating query
length percentage that is consisted in the aligned piece. It is
calculated over total score or all segments.
4. E-value are value of alignments predicted by chance with a
specific score. e
E-value is inversely proportional to significance of score.
Equation:
E-val = P-val * N
ing questions. a. What does BLAST do and how is it useful for your experiment? b....
1. How do UPGMA and NJ similar? 2. How does the BLAST algorithm work? What is a ‘word’? How are words derived from the input (query) sequence? Once words are identified from the input, what is searched? How does BLAST extend a match? 3. How do BLOSUM and PAM compare? What’s similar between the two? What’s different? How do sequence search algorithms (e.g., BLAST) and transition matrices (e.g., BLOSUM and PAM) relate?
please answer questions with the following BLAST results
For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
PDB BLAST, NCBI BLAST, and KEGG all use E values to describe the sequences matching the query. How does the E value differ (if at all) between these programs? Explain your answer. Throughout these lab exercises you have analyzed sequences using protein BLAST (pBLAST) through NCBI, the PDB, and KEGG. How do these BLAST programs differ from one another, if at all? Explain your answer.
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
Experiment Questions What is an epoxide and how is it useful with respect to synthesis design? • What are typical reagents used for epoxidation? • What is the mechanism for epoxidation? Must stereospecificity be considered? Experiment Techniques • Use of sodium bisulfite wash to remove excess peroxy acid from reaction mixture. Introduction By now you are well aware that the product of previous experiment (reaction of cyclohexanol and acid) is an alkene. You should also be storing key reactions of...
: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637.......: Use P04637 as the query for PSI-BLAST search, select the nr database, exclude all primate organism(s), and run many iterations until obtaining the hit of Electrophorus electricus. (revise with more limitation of information) Report for P04637 a. Locus name & gene name b....
x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...
What does the enzyme reverse transcriptase do? How might that be useful for studying RNA viruses like SARS-CoV-2?
QUESTIONS 1) Do a BLASTP search using RBP4 (NP_006735), restricting the output to Arthropoda (Insects). How many databases matches have an Evalue less than 0.01 in this search? (10 points) 2) Next, do a BLASTN search using the RBP4 nucleotide sequence (NM_006744). For this query, select only the nucleotides corresponding to the coding region of the DNA. (To do this visit the NCBI Nucleotide page, follow the link to the coding sequence [CDS), then choose the FASTA format.) How many...
The E-value is a measure of how significant the similarity is between two sequences. The lower the E value, the more significant the match (i.e., the more confident you should be that the sequence BLAST found is a biologically interesting match). (A reminder of the shorthand used in the BLAST results page: an E-value of 8e-21 is 8 times 10^-21 in scientific notation.) (a) According to the YouTube video, what is the maximum E value score that could still be...