Question

3. The following is a DNA coding strand sequence encoding the C-terminus of a protein: 5...A TCTTG GTTGACAACAGTT G A...3
media%2Fd88%2Fd88a547e-447f-469e-a783-f2
The C is located between the two Gs
A T C T T G "C" G
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

The given DNA coding sequence encoding the C-terminus of the protein is:

5'-ATCTTGGTTGACAACAGTTGA--3'

If a C nucleotide is inserted at the location indicated by the arrow, describe the effect of the mutation on the protein

The new sequence after the insertion of the C is:

5'-ATCTTGCGTTGACAACAGTTGA--3'

Effect of this mutation on protein

The mRNA sequence correspoding to this coding strand will be:

5'- AUCUUGCGUUGACAACAGUUGA - 3'

The sequence of protein that will be translated from the mRNA sequence is:

Isoleucine-Leucine-Arginine-Stop codon

The mutation will cause the translation to terminate after Arginine due to the presence of stop codon.

Add a comment
Know the answer?
Add Answer to:
The C is located between the two Gs A T C T T G "C" G...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

  • The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help...

    The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C...

    Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T   A   C A   C   C   G   G   T   C   A   G   G   T   G A   T   C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...

  • If one strand of DNA has the sequence C-T-A-C-C-G-T-T-A, what sequence would appear opposite it on...

    If one strand of DNA has the sequence C-T-A-C-C-G-T-T-A, what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens.

  • 4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...

    4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 3: 5'ACTGCCCATGGTGGTACCT GAC TCC TGAGGAG 3' On the line above, write the sequence for the template DNA strand. On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Translate the following DNA sequence: DNA template: 3' G C T A C C G G...

    Translate the following DNA sequence: DNA template: 3' G C T A C C G G A G T A A T A C T 5' What are the tRNA anticodons for the sequence? DNA template: 3' G C T A C C G G A G T A A T A C T 5' anticodon 1: 3' 5' anticodon 2: 3' 5' anticodon 3: . 3' 5' anticodon 4: 3' 5' anticodon 5: 3

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT