Using sequence GU324922 search Entrez Gene. Write a summary of the information found pertaining to this...
Using sequence GU324922 search Entrez Gene. Write a summary of the information found pertaining to this sequence.
Homework Answers
it is a sequence of hemoglobin beta subunit of homo sapiens. it is a protein coding gene. mutation in this gene results in beta thalassemia which is milder form of thalassemia major. this gene is conserved in chimpanzee, rhesus monkeys, dogs, mouse and rats. 7 organisms have orthologs(genes in different species evolved frm same ancester) with this gene. gene is involved in various functions such as haptoglobulin binding, oxygen binding, oxygen transporter activity, iron binding activity etc.
Add Answer to:
Using sequence GU324922 search Entrez Gene. Write a summary of
the information found pertaining to this...
Write a logical expression for a Web search engine to find sites pertaining to coastal wetlands...
Write a logical expression for a Web search engine to find sites pertaining to coastal wetlands in Louisiana but not in Alabama.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
write a flowchart searching sequence protocol using a pair of DNA sequences of vioB gene isolated...
write a flowchart searching sequence protocol using a pair of DNA sequences of vioB gene isolated from chromobacterium violaceum based on i ) its translation and ii ) potential open reading frame, iii ) the family it belongs to, iv ) its function and v ) structural forms. ( 12 marks ) please show clear and complete answers tq
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
Use the following information to answer the questions below. You have isolated a gene sequence f...
Use the following information to answer the questions below. You have isolated a gene sequence from the mustard plant Arabidopsis and have BLAST searched the NCBI database. Your sequence hit several EST sequences that were identified as transcription factors. These sequences were found in E.coli, Chlamydomonas (a green algae), yeast, mice, and humans and only had a few base pair differences. What can be surmised about your transcription factor? It is unique to Arabidopsis. It is likely involved in a...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
In python! Objective: students will be able to 1.access string elements by index operator 2.search for...
In python! Objective: students will be able to 1.access string elements by index operator 2.search for simple pattern in strings Specification: Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a trilet TAG, TAA, or TGA. The length of a gene string is a multiple of 3 and the gene does not contain any of the triplets...
Q8 - Construct a Binary Search Tree by inserting the following sequence of numbers. 5,6,3,2,10,4,1,7,9,8. Write...
Q8 - Construct a Binary Search Tree by inserting the following sequence of numbers. 5,6,3,2,10,4,1,7,9,8. Write down the level ordered traversal sequence of the final tree after insert. Delete node 10, 8, and 6 step by step using in-order successor. Write down the level ordered traversal sequence after every delete. I want you to write down (1 level ordered traversal for the insert and 3 level-ordered traversals for the deletes). In total there should be 4 level-ordered traversal sequences in...
A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that...
A reporter gene is an experimentally engineered regulatory DNA sequence from a gene of interest that has been fused to a gene that encodes a protein that is easily observed experimentally. Why is this approach useful? a. It provides information on the binding interactions of the gene product. b. It provides information into where and when a gene is expressed. c. It can provide information as to where a gene is expressed. d. It can provide information as to when...
5. Using arrows, write the flow of genetic information in correct sequence for the following three...
5. Using arrows, write the flow of genetic information in correct sequence for the following three components: mRNA, protein (amino acid sequence), DNA 14-121 PEA
Write a logical expression for a Web search engine to find sites pertaining to coastal wetlands in Louisiana but not in Alabama.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho
5. Using arrows, write the flow of genetic information in correct sequence for the following three components: mRNA, protein (amino acid sequence), DNA 14-121 PEA
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago