Question

2. You observe a piece of mRNA. A few minutes later you see this mRNA has...

2. You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA. How is this possible? Explain the protein responsible to do this. Also, what other sequences can this protein convert? What can this help researchers determine?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The enzyme reverse transcriptase uses the mRNA template to produce a complementary single-stranded DNA strand called cDNA in a process known as reverse transcription. Next, DNA polymerase is used to convert the single-stranded cDNA into double-stranded DNA.

Reverse transcriptase is the protein that converts mRNA to DNA.

The process is called reverse transcription .

Used in polymerase chain reaction.

Add a comment
Know the answer?
Add Answer to:
2. You observe a piece of mRNA. A few minutes later you see this mRNA has...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You observe a piece of mRNA. A few minutes later you see this mRNA has now...

    You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA. How is this possible? Explain the protein responsible to do this. Also, what other sequences can this protein convert? What can this help researchers determine?

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence:...

    can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • Background Information How can we predict where a coding gene will be in bacteria? And can...

    Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...

  • C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...

    C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...

  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....

  • What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the...

    What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the DNA immediately upstream of the transcription start site, but expression of the gene can also be affected by control elements. These can be thousands of base pairs upstream of the promoter, grouped in an enhancer. Because the distance and spacing of these control elements make them difficult to identify, scientists begin by deleting sections of DNA that contain possible control elements and measuring the...

  • A series of mutations caused a DNA sequence to change from ATCGATAA to GGCGGTAA. Which of...

    A series of mutations caused a DNA sequence to change from ATCGATAA to GGCGGTAA. Which of the following sequences do you think will take longer to replicate? Thoroughly explain! A scientist is interested in studying the unfolded protein response in an unknown (has not been previously studied) mutant cell line. The scientist treats the cells with heat to cause the proteins in the ER to denature. Unfortunately, the scientist does not measure any chaperone activity in the ER. The scientist...

  • The following gene sequence has been obtained (only for the first few amino acids). You are...

    The following gene sequence has been obtained (only for the first few amino acids). You are provided with the following gRNA spacer sequence to target a specific region of this gene: You are also provided with the following repair template sequence to introduce a specific mutation in this sequence through homology-directed repair (HDR): What is the mutation introduced by this repair template? What are the consequences of this mutation? (2pts) What would be possible sequences of two forward primers that...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT