Question

Sample Question: The start of the coding region for the human B-globulin gene reads 5-ATGGTGCAC-3. What is the sequence of
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

coding region:.    5' -ATGGTGCAC- 3'

complimentary sequence: 3'-TACCACGTG-5', on reversing the complementary sequence we get the complimentary strand

complimentary strand: 5'-GTGCACCAT-3'

Because of the nature of complementary base pairing, if you know the sequence of one strand of DNA, you can predict the sequence of the strand that will pair with, and it is known as the complementary strand. A pairs with T and G pairs with C.

Remember to give the correct 5' to 3' orientation

when writing complementary DNA sequences, you need to write the sequence in the 5' to 3' direction. This usually involves reversing the sequence after writing it complementary to the one you are given.

Add a comment
Know the answer?
Add Answer to:
Sample Question: The start of the coding region for the human B-globulin gene reads 5'-ATGGTGCAC-3'. What...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...

    QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...

  • If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...

    If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X

  • Below is the partial coding strand of DNA for a gene containing an ORF, shown 5'...

    Below is the partial coding strand of DNA for a gene containing an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9, associated with the following genetic elements. Some elements may have more than one associated region. (a) The promoter region (b) The ribosome binding site (c) The ribosome binding site consensus sequence (d) The start codon (f) The expected region for the +1 transcription (where the transcript begins to be made) (g) Is this a prokaryotic...

  • 7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...

    7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...

  • ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin...

    ԿԱՆՉՈ» 2. Genes are made of DNA nucleotides. The gene for the beta chain of hemoglobin is 1,734 nucleotides in length and is located on the human chromosome 11. The mutation responsible for sickle-cell anemia affects a single nucleotide, which in turn changes a single amino acid. (9 pt) a. How are these nucleotides joined together to form a long polynucleotide chain? Name the relevant nucleotide constituents important for making the linkage. (see Slides 5-7 of Lecture 4b) (2 pt)...

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • Question 5: Use accession number “CU329670” to search the Nucleotide database. a. What is the type...

    Question 5: Use accession number “CU329670” to search the Nucleotide database. a. What is the type of sequence? What is the length of sequence? What is the name of database division? b. What is the scientific name of organism? Go to the FEATURES section of the record. Link to the CDS to gain access to the first 5662 nucleotides of the sequence. c. Name the protein product of the CDS and the length of protein. d. Write the first four...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT