Question
why the answer is B
d start codon in groups of three bases Answer 3. The fourth codon in an mRNA sequence is GGG which specifies glycine. If we a
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The direction of protein synthesis is from amino or N terminus to carboxy or C terminus. Since the fourth codon is GGG which codes for glycine, so the fourth amino acid from the N-terminus is glycine.
Option B is correct

Option A is wrong ( GGG is at fourth position from the N-terminus not at the third position).

Option C is wrong ( Direction of protein synthesis is from N terminus to C terminus).

Option D is wrong (Position of GGG is fourth from the N terminus not from the C terminus).

Add a comment
Know the answer?
Add Answer to:
why the answer is B d start codon in groups of three bases Answer 3. The...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon...

    For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon D. translation _8. The sequence of bases that serves as the language of life _9. A sequence of 3 bases on a tRNA molecule that is complementary to sequences of bases on an mRNA molecule. 10. How genetic information is put into action in a I living cell 11. The decoding of an mRNA into a protein 12. A chain of amino acids 13....

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • ​5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why?

    5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why? 5.2. does the underlined bold ATG open an ORF? why? 5.3 which ATG seems to be a valid start codon? Copy the sequence into the answer box and make the start codon bold and underlined. Split the ORF portion into codons fone blank between codons, like this ATG CCC GGG.... Keep the font Courier to keep all symbols equal width. If the copying process...

  • Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of...

    Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...

  • Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...

    Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...

  • 3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...

    3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....

    What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...

  • Which of the following is not an essential function of ribosomes in all domains of life?...

    Which of the following is not an essential function of ribosomes in all domains of life? A. Catalyze peptide bond formation between amino acids during polypeptide formation. B. Bind messenger RNA and identify the start codon where translation begins. C. Facilitate the complementary base pairing of mRNA codons and tRNA anticodons that determines amino acid order in the polypeptide. D. Align the Shine Delgarno sequence in the mRNA with a complementary sequence in the 16S rRNA of the small ribosomal...

  • Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...

    Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT