Homework Answers
The direction of protein synthesis is from amino or N terminus
to carboxy or C terminus. Since the fourth codon is GGG which codes
for glycine, so the fourth amino acid from the N-terminus is
glycine.
Option B is correct
Option A is wrong ( GGG is at fourth position from the N-terminus not at the third position).
Option C is wrong ( Direction of protein synthesis is from N terminus to C terminus).
Option D is wrong (Position of GGG is fourth from the N terminus not from the C terminus).
Add Answer to:
why the answer is B
d start codon in groups of three bases Answer 3. The...
For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon...
For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon D. translation _8. The sequence of bases that serves as the language of life _9. A sequence of 3 bases on a tRNA molecule that is complementary to sequences of bases on an mRNA molecule. 10. How genetic information is put into action in a I living cell 11. The decoding of an mRNA into a protein 12. A chain of amino acids 13....
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why?
5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why? 5.2. does the underlined bold ATG open an ORF? why? 5.3 which ATG seems to be a valid start codon? Copy the sequence into the answer box and make the start codon bold and underlined. Split the ORF portion into codons fone blank between codons, like this ATG CCC GGG.... Keep the font Courier to keep all symbols equal width. If the copying process...
Genetics! help please May S Tae suumissis hot be accepted. 1. (10 points) A series of...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...
3. What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
Which of the following is not an essential function of ribosomes in all domains of life?...
Which of the following is not an essential function of ribosomes in all domains of life? A. Catalyze peptide bond formation between amino acids during polypeptide formation. B. Bind messenger RNA and identify the start codon where translation begins. C. Facilitate the complementary base pairing of mRNA codons and tRNA anticodons that determines amino acid order in the polypeptide. D. Align the Shine Delgarno sequence in the mRNA with a complementary sequence in the 16S rRNA of the small ribosomal...
Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...
Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...
For Questions 8-13, match the term with its definition. A. polypeptide B. genetic code C. codon D. translation _8. The sequence of bases that serves as the language of life _9. A sequence of 3 bases on a tRNA molecule that is complementary to sequences of bases on an mRNA molecule. 10. How genetic information is put into action in a I living cell 11. The decoding of an mRNA into a protein 12. A chain of amino acids 13....
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
5.1 the underlined bold TAC is an ATG on the other strand. Is this a start codon? why? 5.2. does the underlined bold ATG open an ORF? why? 5.3 which ATG seems to be a valid start codon? Copy the sequence into the answer box and make the start codon bold and underlined. Split the ORF portion into codons fone blank between codons, like this ATG CCC GGG.... Keep the font Courier to keep all symbols equal width. If the copying process...
Genetics! help please
May S Tae suumissis hot be accepted. 1. (10 points) A series of tRNAs have the anticodon sequences shown below Considering wobble, use Figure 13.12 to determine the possible codons with which each tRNA could pair Posible codons (Indicate the s end of each codon) Anticodon sequence 5-ACG-3 5'-xm UmGG-3 5'-IGA-3' Indicate which amino acid would be covalently bonded to tRNAs with the anticodon sequences given above. Use Table 13.1 to help you with your answer. Anticodon...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago