A single point mutation in a gene results in a nonfunctional protein. Individuals heterozygous for this mutation were identified using a Southern blot. Which pair of wild-type (WT) and mutant alleles most likely contains the mutation? Why is " A" the correct Answer. Can you please explain. Thank you! Step by step.




All options A, B, C will have mutation for sure but in case of option D, mutation may or may not happen because only 3rd nucleotide of a codon is changed (if u have provided the question with correct reading frame) because of degeneracy.
Option A is the correct answer because the single point mutation is occurring in the middle of a codon which will lead to formation of different amino acid and hence a dysfunctional protein. And also ATG or AUG (it is getting mutated from AAG to ATG) is the start codon which is not the case in option B and C even if the mutation is happening.
probability of getting a dysfunctional protein in descending order is
Option A>> Option C>> Option B>> Option D
A single point mutation in a gene results in a nonfunctional protein. Individuals heterozygous for this...
2. You've identified a mutant allele for a new gene in mice that causes muscle hypertrophy You've named the gene Mh, so the wild-type allele is Mh, while the big-muscle mutant allele you've designated as Mh89, You believe this gene is involved in muscle growth and development, but you haven't been able to isolate the protein yet. You also do not know exactly where the mutation is in the gene, but you do know that the mRNA transcript of the...
Can someone please help me with numbers 4 and 5?
A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...
Below is the coding DNA sequence for a gene called tribble, including the wild-type and several mutant alleles. For each mutant allele, fully classify the mutation and its effect in the amino acid sequence. Wild-type 5'-ATGGCAACTACATATAGCACAGTTTGAACC-3' a. Mutant allele #1 5'-ATGGCAACTACATAAAGCACAGTTTGAACC-3' b. Mutant allele #2 5'-ATGGCAACTACATATAGCATAGTTTGAACC-3' c. Mutant allele #3 5'-ATGGCAACTACATACAGCACAGTTTGAACC-3' d. Which mutant allele is most likely to be a knockout and why?
With respect to genetics, ABO blood types are controlled by a single gene designated I, which has three alleles. The I A allele gives blood type A, I B gives blood type B, and i gives blood type O. The I A and I B alleles are codominant and i allele is recessive to both the I A and I B alleles. Aside from the I alleles, there are two other genes that when mutated affect ABO blood type inheritance....
What is protein X and what gene could be mutated to cause these results? Wild type Mutant DNA Protein X DNA Protein X Compound Compound Untreated US Protein X is a nuclear hormone receptor. The mutation is in protein X and it no longer binds compound S. Protein X is a nuclear hormone receptor. The mutation is in protein X and increases its affinity for compound Protein X is NFAT. The mutation is in the GPCR that binds compound U...
Do you expect a Pro→Gly mutation in a surface-loop region of a
globular protein to be stabilizing or destabilizing? Assume the
mutant folds to a native-like conformation. Explain your answer in
terms of the predicted enthalpic and entropic
effects of the mutation on the ΔG for protein folding compared to
ΔG of folding for the wild-type protein.
Match the items in the left column to the appropriate blanks in
the sentences on the right.
ASsolvent Because the mutation is on...
A cell that is heterozygous for a nonsense mutation in a tumor suppressor gene would most likely: A) Group of answer choices B) grow but not divide C) have a normal cell cycle D) arrest and induce apoptosis E) have a slightly increased cell cycle and increased cell growth F) grow and divide uncontrollably Which of the following correctly describes an event that occurs during transcription: Group of answer choices A) A DNA molecule is chemically modified to become a...
Question 20 (1 point) Figure out the mutation. You will need the codon table to answer this question. Wild type genomic sequence of a portion of a gene and the wild type sequence of portion of the protein gene product. The protein sequence only matches partially. TAT AAA GGG CGA CCA CCT GGT AAT GGG ACT TTG AGG Tyr Lys Gly Arg Pro Pro Ala Pro Arg Gin Tyr Trp Note: The five amino acids at the amino end of...
Actice: Mutations - A -P--I--3--H--N--R--6--8- --11--11-- - ----- CGI GATTIOTITATITCATCCARAGATCTGGGC ATGACHATAGCTATCTACH --6-- -F-- - --5--5--K -3 -4--G-- ----y--5--4--1--0 -- -- SOBOTACECCO THACACOLAGACICITITCAAGACTACATTAASTCCTATTTGGAACAAGCGAC CG 3 -D-P-- -- -- - -- -- --I--K -3-wY--1-- --0-- --3--2 MES CATCH.CCTCRIGGST SELCATOGICCITGGGGCCGCGADGGLAGGCGCSGTCC CACHGCOCTOCT 3GC --3-- -- -- -- -- -- - - -- 173 W 179 AGGCT GTGAGTT AGTIGCTGIGTCGI CACAAGAGAAAGCAGCTCCTGAAGAARSCAGOGI -s--1 -1 - 6 -R- -11--1--2--3--0--I -F - 6--6--8--0--p RTCCTCATCCAGAAGAGGA TACCACAGCHET 13 -1 1 -- --3--R-- -- - BAGGATACCACAGTGTATORGAGCCWT TATAA........ -- -- -- - -...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...