Question

In an experiment with agarose gel eletrophoresis, the DNA samples are loaded in the wells within...

In an experiment with agarose gel eletrophoresis, the DNA samples are loaded in the wells within the gel and the electric current is turned on. When observing the samples, you notice that the DNA fragments are moving in the opposite (wrong) direction. What possible error could have caused this to occur?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Solution

  • Electrophoresis is the technique of separation of DNA fragments according to there size and charges across electric field.
  • DNA molecule has net negative charges so they are always moves towards positive electrode.
  • If we change the polarity of electrode, positive electrode at loading site then DNA fragments not moving properly in there desired direction.so they choose direction towards positive electrode.
  • So this is the cause that positive electrode is present at the site of well of DNA loading site.so fragments are moves in wrong direction.
Add a comment
Know the answer?
Add Answer to:
In an experiment with agarose gel eletrophoresis, the DNA samples are loaded in the wells within...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The picture above represents an agarose gel that was used to analyze plasmid DNA after it...

    The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...

  • EXERCISE 17.2: Sketch an agarose gel for use in separating DNA. Make sure you label: (a) The location of the wells (b) T...

    EXERCISE 17.2: Sketch an agarose gel for use in separating DNA. Make sure you label: (a) The location of the wells (b) The positive electrode (c) The negative electrode ( d) The direction of migration of the DNA in the gel

  • After PCR is performed the products are run out on an agarose gel. In the figure...

    After PCR is performed the products are run out on an agarose gel. In the figure below, grey bands represent the wells the PCR product was loaded into. The white bands represent DNA fragments produced by PCR. The target fragment amplified by the primers was 1,500 bp in size. The ladder is a standard DNA ladder containing bands of various sizes between 5,000 and 1,000 bp. The negative control contained only molecular grade water*. The positive control contained DNA known...

  • NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the...

    NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...

  • Sketch the predicted migration pattern on an agarose gel of the following DNA samples: (1) Undigested...

    Sketch the predicted migration pattern on an agarose gel of the following DNA samples: (1) Undigested pET15b plasmid; (2) pET15b digested with the EagI restriction enzyme; (3) pET15b digested with NdeI and AhdI (see pET15b vector map for location of these enzyme cutting sites). Include in your sketch a DNA base-pair ladder from 0 to 10,000 bp with 1000 bp increments. Label each band in the DNA ladder with the known size (in base-pairs), and estimate the size of the...

  • What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly,...

    What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly, with the wells closest to the positive electrode? Choose one: A. DNA would remain in the gel. B. DNA bands would appear smeared. C. DNA would be pulled through the gel in the wrong direction. D. DNA would not fluoresce under UV light.

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • Refer to the picture included in question 7 for this question. Please explain how gel electrophoresis...

    Refer to the picture included in question 7 for this question. Please explain how gel electrophoresis separates the DNA fragments that are produced by the Sanger technique. Include the following elements within your explanation (not necessarily in order of how you should place them in your answer): electric current and charge size of DNA molecules DNA samples gel wells and buffer solution. I I III I

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in...

    a) What is the total net charge of double-stranded DNA that is 500 basepairs (bp) in length? b) In agarose gel electrophoresis, two parallel and oppositely charged electrodes are situated at opposite ends of the gel. The surrounding solution is a “buffer”, an aqueous salt solution maintained at constant pH. The gel is made in the same buffer, with a small concentration of agarose. Because the concentration of agarose is small , everything between the electrodes can be considered to...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT