1.The change of the base sequence of eukaryotic RNAs after they have been transcribed is known as
-RNA editing
-Base modification
-Processing
-Splicing
2. true or false.. during elongation of transcription, RNA polymerase is primarily in a closed complex.
3.
In sickle cell anemia, the β-globin gene has a valine at position 6 instead of the normal glutamic acid. The remaining protein sequence is unchanged. This is an example of which of the following types of mutations?
- Silent mutation
-Nonsense mutation
-Missense mutation
-Frameshift mutation
4. Which of the following eukaryotic mRNA species is the most stable? (Note: only the 3’ – UTR is shown below)
Group of answer choices
5’ – GGCCGGGUUUAAUUUAAUUUAAAAA – 3’
5’ – GGCCGGGAAAAAAAAAAAAAAAAAA – 3’
5’ – GGCCCGGGUUUAAAAA- 3’
5’ – GGCCCGGGAAAAAAAA- 3’


1.The change of the base sequence of eukaryotic RNAs after they have been transcribed is known...
Need help with biochemistry please
3. RNA splicing. Eukaryotic mRNAs are frequently spliced before they are translated. Algae have the smallest known intron. The sequence of the algal pre-mRNA before splicing occurs is shown below. exon 1 intron exon 2 5-AUGGAAAUUAAGUACUAUAUUGAAUUUCAGGUUGAAGAUUUAGGAAUGG-3' A) What is the sequence of the mature mRNA after splicing occurs? 5'- -3' B) What is the sequence of the polypeptide after translation occurs? (N-terminus) (C-terminus) C) Identify the type of mutation in the following mutant pre-mRNAs. [In...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG GGT ACA TTC GGC CCA TAC 3’ DNA 3’ TAC GGC CCA TGT AAG CCG GGT ATG 5’ RNA 5’ AUG CCG GGU ACA UUC GGC CCA UAC 3’ Protein met pro gly thr phe gly pro. tyr DRAW an example of each of the following (circle the mutation that has occurred): A silent mutation A frameshift mutation A nonsense mutation A missense mutation
There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.
Bis
101 help
Question 6 1 pts 6. (1pts) The following DNA sequence 5- AGTCGCCCATGCCG-3'undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation D Question 7 2 pts 7.(2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been...
A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...
1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...