A phylogenetic tree uses data to indicate relatedness of different species. This webpage explains how to construct a phylogenetic tree using differences in molecular sequences (such as differences in amino acids, or differences in nucleotides).
Numbers in the table below represent mutational differences in a particular gene. Higher numbers indicate more genetic differences between two species. The longer two species (or subspecies) are isolated, the more likely there will be an accumulation of mutational differences.
discription of cluster analysis method that will help in constructing phylogenetic tree -
I. Cluster Analysis is a very general technique for inferring phylogenetic trees. The most widely used varient is the UPGMA method (unweighted pair-group method with arithmetic mean) and Fitch-Margoliash method
The UPGMA (Unweighted Pair Group Method with Arithmetic mean) -
methods produce rooted trees and require a constant-rate assumption - that is, it assumes an ultrametric tree in which the distances from the root to every branch tip are equal.
Fitch-Margoliash method-
The Fitch-Margoliash method uses a weighted least squares method for clustering based on genetic distance. Closely related sequences are given more weight in the tree construction process to correct for the increased inaccuracy in measuring distances between distantly related sequences. In practice, the distance correction is only necessary when the evolution rates differ among branches. The distances used as input to the algorithm must be normalized to prevent large artifacts in computing relationships between closely related and distantly related groups. The distances calculated by this method must be linear; the linearity criterion for distances requires that the expected values of the branch lengths for two individual branches must equal the expected value of the sum of the two branch distances - a property that applies to biological sequences only when they have been corrected for the possibility of back mutations at individual sites. This correction is done through the use of a substitution matrix such as that derived from the Jukes-Cantor model of DNA evolution.
The least-squares criterion applied to these distances is more accurate but less efficient than the neighbor-joining methods. An additional improvement that corrects for correlations between distances that arise from many closely related sequences in the data set can also be applied at increased computational cost. Finding the optimal least-squares tree with any correction factor is NP-complete,so heuristic search methods like those used in maximum-parsimony analysis are applied to the search through tree space.
Please explain! Suppose you sequence a 30-base-pair segment of DNA in five different species (A, B,...
How does the major groove encode information about the base pair sequence of DNA? Please explain throughly, I will rate well for an informative answer!
"A 26 base pair long sequence of DNA is known to bind only at the human locus for catalase-A (an enzyme used in metabolism). When labeled with a fluorescent dye, this sequence is used as one primer for PCR amplification. A second, unlabelled primer of the sequence ACGG is used, and the PCR is cycled 20 times. When the resulting amplified DNA is run on a gel, individual A has two different bands, one at 370 BP and one at...
A part of the aminoacid sequence in Cytochrome-C protein from 6 different species is given in the table. Rank the organisms from 1 to 5 according to the similarity of the organism to human: based on the similarity between the cytochrome C aminoacid sequences, 1 being the closest to human. It is largely agreed that the greater the number of amino acid (or nucleotide) differences between a given pair of organisms, the further apart they are in evolution. On the...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
please explain
15. If you are amplifying a target sequence of 3.0 kb from a genomic DNA sample of size 3.0 x 10 kb, after 20 rounds of PCR what percentage of the total DNA would be your target sequence? 3.0-10 C. f= 220 X3.0 2 20 X3.0 B. f 220X3.0+3.0-1051.2% 2 30 =95.4% 104.9% A. f X3.0 3.0x10 16. The differences in the human genome between individuals are called B. genetic micro-satellites (GMS) D. minor allele frequency (MAF) A....
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
please answer ( c ) and ( b )
Read each question carefully, Write your response in the space provided for an question. Answers must be written out in paragraph form. Outlines, buleted alone are not acceptable and will not be scored. Researchers studying the phylogenetic relationships among African elephants (Loxodonta arricana), Asian elephants (Elephas maximus), and woolly mammoths (Mammuthus primigenius) analyzed cytochrome b DNA sequences from several organisms of each species. Cytochrome b is a mitochondrial protein that functions...
Please match the terms on the left with descriptions on the right to review terminology and concepts that have arisen from completion of human and model organism genome sequences. (Not all terms have a match.) gene desert Genes in two different species that arose from the same gene In the species' common ancestor. Skipped protein domain Gones that arose by duplication within a single species, often within the same chromosome paralogous genes gene family A discreto functional unit encoded by...
please explain
Mailings Review View ferences av A. A AaBbCcDdEe 211 av AalbCcDdte AaBbCcD AaBbCcDdE AaB No Spacing Heading 1 Heading 2 Title Normal 1a. Given your understanding of transcription and translation, fill in the blanks below for each nucleotide and polypeptide sequence. Assume that translation requires a start codon, and that there is no processing of the pre-mRNA before translation. Non-template strand of DNA: 5' CAGTATGT ATGACAAT GCA 3' Template strand of DNA: 3" GTCAT A CATAC TGTTA CGT...