Assuming that a DNA sequence has equal number of four bases, What would be the average...
Homework Answers
Answer:
The average size of the pieces formed by cutting the DNA with EcoR1 restriction enzyme: 4096 basepairs long
Recognition sequence of EcoR1: GAATTC
Frequency of EcoR1 site in a sequence of nucleotide: for every 4096 basepairs
Method:
DNA has 4 nucleotides (A, T, G, C) and the recognition site is 6 nucleotides long.
So 46 = 4096 bp long.
Add Answer to:
Assuming that a DNA sequence has equal number of four bases,
What would be the average...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Help with these two would be appreciated JUVIJVVEL In a large unbiased random DNA sequence, how...
Help with these two would be
appreciated
JUVIJVVEL In a large unbiased random DNA sequence, how often would you expect a 6 base targeting site specific restriction enzyme to cut? O On average every 4096 base pairs (446) O Never O On average every 1.296 base pairs (6^4) O Every 6 base pairs QUESTION 5 2 points Save Answer How do bacteria possessing restriction systems avoid targeting and cutting their own DNA? By methylating their chromosomal DNA O By methylating...
To estimate the number of cleavage sites in a particular piece of DNA with a known...
To estimate the number of cleavage sites in a particular piece of DNA with a known size, you can apply the formula, N/4 n where N is the number of base pairs in the target DNA and n is the number of bases in the recognition sequence of the restriction enzyme. If the recognition sequence for Sau3AI is GATC and the Haemophilus influenzae genome contains approximately 1,830,000 bp, how many cleavage sites would you expect?
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
Targeting a DNA sequence for editing by the CRISPR‑Cas9 system requires that a protospacer‑adjacent motif (PAM)...
Targeting a DNA sequence for editing by the CRISPR‑Cas9 system requires that a protospacer‑adjacent motif (PAM) sequence appear just downstream of the target sequence. For S. pyogenes Cas9 this PAM is the trinucleotide NGG, where N represents any nucleotide. Assuming a fragment of DNA includes equal amounts of A, C, G, and T bases, how many bases apart, on average, would one expect to find the NGG PAM? how many bases average PAM distance =
15. A new bacterial species was found and its DNA was analysed. It has a 50%...
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Help with these two would be
appreciated
JUVIJVVEL In a large unbiased random DNA sequence, how often would you expect a 6 base targeting site specific restriction enzyme to cut? O On average every 4096 base pairs (446) O Never O On average every 1.296 base pairs (6^4) O Every 6 base pairs QUESTION 5 2 points Save Answer How do bacteria possessing restriction systems avoid targeting and cutting their own DNA? By methylating their chromosomal DNA O By methylating...
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago