Question

During a single crossover event, how many strands of DNA must break? (Recall that DNA is...

During a single crossover event, how many strands of DNA must break? (Recall that DNA is double-stranded)
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Homologous recombination is exchange of two DNA sequence in a region that is identical or with shared homology. Homologus recombination occurs during prophase 1 of meiosis. Crossing over is the exchange of genetic material between non sister chromatid in meiosis.Crossover in homologus chromosomes are initiated by double stranded breaks in the DNA. Crossovers are tightly regulated processes.

A single crossover event occurs when there is alignment of homologous chromosomes. There is exchange of genetic material between different chromatids during recombination at a single point. Both the strands of DNA have to be broken for single crossover events to occur. Double stranded breaks during meiosis will occur only after DNA replication is over. A DNA nuclease creates double stranded breaks during recombination. In mitosis, however, either single stranded or double stranded breaks are created. Double stranded break is common during homologus recombination in all species, whether single crossover or double crossover. In a single crossover event, there is breakage of 2 strands of DNA in each sister chromatid. Hence, there will be breakage of total 4 strands of DNA, as each sister chromatid has double stranded DNA (there are two sister chromatids involved in single crossover event).

Add a comment
Know the answer?
Add Answer to:
During a single crossover event, how many strands of DNA must break? (Recall that DNA is...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...

    Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed. What is the enthalpic term favoring single stranded DNA? A. Hydrogen Bonding B. Conformational C. Base Stacking D. van der...

  • 20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded...

    20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...

  • BIU A A E 8. A DNA molecule has two strands (double helix) – how many...

    BIU A A E 8. A DNA molecule has two strands (double helix) – how many of its strands are/is used during replication and transcription? 9. What is the difference between transcription and translation occurring in Prokaryotes and eukaryotes? 10. What is the relation between mRNA and genetic code? 11. Using genetic code table-list the corresponding aminoacids for triplet code: CAG, GAG, CAC, AUA, GUA, GCA and UGA, UAA and UAG 12. How many start and stop codons are there?...

  • When does recombination occur? A. During meiosis B. In response to a single- or double-stranded break...

    When does recombination occur? A. During meiosis B. In response to a single- or double-stranded break in DNA C. During antibody formation D. When catalyzed by a recombinase E. All of the above

  • 6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA...

    6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • [Choose] Coats single-stranded DNA, preventing duplex formation Replaces RNA primers with DNA nucleotides breaks hydrogen bonds,...

    [Choose] Coats single-stranded DNA, preventing duplex formation Replaces RNA primers with DNA nucleotides breaks hydrogen bonds, unwinding DNA double helix Synthesizes DNA 5' to 3' on leading and lagging strands Relaxes supercoiled DNA Catalyzes phosphodiester bond formation, joining DNA fragments Leading strand Lagging strand synthesizes RNA primers on leading and lagging strands [Choose)

  • 44. During DNA replication, the double helix is unwound, creating two single strands. One of these...

    44. During DNA replication, the double helix is unwound, creating two single strands. One of these is called the strand, on which the progress of DNA Polymerase III is – 45. The other strand is called the strand, on which the synthesis is 16. During DNA replication, synthesis of a new sequence on the Leading Strand is continuous. Why is synthesis on the Lagging Strand discontinuous? 47. Generation of Okazaki fragments proceeds in three steps. Indicate which of the following...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • Label DNA Replication process from first events to last events please. Reset Help Hydrogen bonds form...

    Label DNA Replication process from first events to last events please. Reset Help Hydrogen bonds form between the complementary bases. Primase synthesizes an RNA primer. Proteins bind to the DNA in order to stabilize the single strands. DNA polymerase catalyzes formation of a sugar-phosphate bond between neighboring nucleotides. Double stranded DNA is unwound by helicase. First event Last event

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT