What is the count of unique DNA sequences that encode for the amino acid polypeptide RAGMPPM? Assume that the DNA sequence has only exon nucleotides. Please provide justification for your answer
| Amino acid | RNA | DNA |
| R | CGU/CGA/CGG/CGC/AGA/AGG | GCA/GCT/GCC/GCG/TCT/TCC |
| A | GCU/GCA/GCG/GCC | CGA/CGT/CGC/CGG |
| G | GGU/GGA/GGG/GGC | CCA/CCT/CCC/CCG |
| M | AUG | TAC |
| P | CCU/CCA/CCG/CCC | GGA/GGT/GGC/GGG |
| P | CCU/CCA/CCG/CCC | GGA/GGT/GGC/GGG |
| M | AUG | TAC |
DNA sequence number
= (6)×(4)×(4)×1×(4)×(4)×1
=1536
DNA sequence from the third column in sequencial manner represent
One of example is
GCA CGA CCA TAC GGA GGA TAC
Because some amino acids are coded by more than one RNA sequence. Each amino acid is coded by the three nitrogen bases. Out of which third position of amino acids is not playing important role in identification of amino acid by tRNA. It is wobble hypothesis. This is a reason for more than one RNA or DNA sequence code for single amino acid.
What is the count of unique DNA sequences that encode for the amino acid polypeptide RAGMPPM?...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
What do you notice about the divergence of the amino acid (protein) sequences when compared to the nucleotide (DNA) sequences? Given a large section of a gene, say a complete exon, how could you determine reading frame?
How many different amino acid sequences are possible in a polypeptide that is 10 amino acids long: Select one: a. 10^20. b. 4120. O c. 10^4. d. 20-10. THEME
Did I answer the mRNA sequences
and Amino acid sequences correctly? What types of mutations are
these? How do you do the bottom?
Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
You are given a DNA sequence that codes for a short polypeptide, TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? state the amino acid sequence of the polypeptide translated from this mRNA.
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from: hydrolysis of GTP hydrolysis of ATP translocation of the ribosome as it moves along the mRNA ribosomal RNA (rRNA) secondary structure transcription of the mRNA that is being translated Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its cognate amino acid, to...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here a) m RN A: 5-CCGCACGGAUAU-3' amino acid sequence: b) mRNA: 5-GGCAACGAGCUC-3' amino acid sequence: c) mRNA: 5'-CAACGUAAUC GA-3' amino acid sequence: Hint O Previous ® Give Up & View Solution 2 Answer Next Ext Check
I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met… Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...