Question

Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a....

Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG
a. Determine the consensus sequence
b. Design an experiment to support the consensus sequence
c. Show the predicted results of your experiment
0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of...

    Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...

  • Consensus sequences that are involved in prokaryotic/bacterial transcription include... A. the -10 consensus sequence or Pribnow...

    Consensus sequences that are involved in prokaryotic/bacterial transcription include... A. the -10 consensus sequence or Pribnow box. B. the -35 consensus sequence. C. enahancer sequences. D. Two of the above. E. All of the above.

  • How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A...

    How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A mutation in the -10 (Pribnow) consensus sequence would have what affect?

  • 4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...

    4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...

  • Which of the following sequence is the right sequence for a bacterial gene? -35 consensus...transcription start...-10...

    Which of the following sequence is the right sequence for a bacterial gene? -35 consensus...transcription start...-10 consensus...coding region...transcription termination transcription start...-35 consensus...coding region...-10 consensus...transcription termination transcription start...-35 consensus...-10 consensus...coding region...transcription termination -35 consensus...-10 consensus...transcription start....coding region...transcription termination

  • Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single...

    Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single base change in a bacterial gene's-35 TTGACA consensus sequence Complete elimination of the inverted repeat/hairpin loop structure and string • of uracils at the 3' untranslated region of a bacterial gene Complete elimination of the consensus sequence for 3 cleavage of a eukaryotic pre-mRNA Complete elimination of a splice site consensus sequence in a eukaryotic gene Abnormally long mRNA with the possibility of a...

  • The constitutive promoter that you placed upstream of your gene is expressing too much of the...

    The constitutive promoter that you placed upstream of your gene is expressing too much of the gene. Which of the following can you use to have it express less? ☐ Make the promoter weaker by changing the sequences of the -10 and -35 regions to their reverse complements ☐ Make the promoter stronger by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences ☐ Make the promoter weaker by changing the sequences of...

  • Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator...

    Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...

  • There is a translation error in which a bacterial gene fails to initiate translation. What is...

    There is a translation error in which a bacterial gene fails to initiate translation. What is one possible problem? A) There were problems in exporting the mRNA out of the nucleus B) There is a mutation at -10/-35 promoter consensus sequence. C) There is a mutation in the Shine-Delgarno sequence D) The 5' Cap is not added so the ribosome cannot find the start codon.

  • 5. Here is another promoter region in E. coli. (Also in a larger format in the...

    5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT