1) Complete elimination of a bacterial gene's shine dalgarno sequence- No effect on transcription, little to no translation.
2) Complete elimination of a gene's promoter- No transcription, No translation
3) A single base change in a bacterial gene's -35 TTGACA consensus sequence- Reduced rate of transcription initiation
4) Complete elimination of the inverted repeat/hairpin loop structure and string of uracils at the 3' UTR of a bacterial gene- No direct effect on transcription, mRNA half life reduced, protein product levels are reduced.
5) Complete elimination of the consensus sequence for 3' cleavage of a eukaryotic pre-mRNA- Abnormally short pre-mRNA with the possibility of short and functional protein.
6) Complete elimination of a 5' splice site consensus sequence in a eukaryotic gene- Abnormally long mRNA and can affect transcription and translation of neighbouring downstream loci.
Explanation for the matches-
1) The shine dalgarno sequence is the sequence on the mRNA in prokaryotes which is complementary to the sequence on the small subunit of the ribosome.This helps the ribosome assembly onto the mRNA to begin transaltion.If this sequence is not there then the ribosomes do not know where to begin the process and hence there will be no translation occuring however transription is not affected.
2) The promoter is the region that is recognised by the RNA polymerase to begin transcription on the gene.This is the region that is upstream to the transcritpion start site. If the promoter is not present then the RNA polymerase cannot identify the region to bind on the DNA and cannot start transcription.If transcription does not occur then mRNA is not produced and hence transaltion also cannot occur.
3) The -35 consensus sequence is a conserved sequence in prokaryotes and is required to be precise for the efficient binding of the RNA polymerase. A change in single base will not affect transcription drastically but it will reduce the strong binding effect of the promoter due to which the rate of transcription of that particular gene will be reduced but not absent.
4) The 3' UTR region of a bacterial gene is necessary for the stability, export and translation efficiency of an mRNA.IT has no role to play in transcription but its removal can affect mRNA stability and reduced protein production.
5) when the 3' cleavage sequence is removed, polyadenylation a process of post transcriptional modification does not occur which means that the poly A tail is not formed and the mRNA has reduced shelf life. hence the pre mRNA is short but can be functional.
6) IF the 5' splice site sequence is removed then splicing (removal of introns and joining of exons) will not take place. Hence the mRNA will be long with a lot of exons(coding) and introns(non coding). and this can affect the regulation of other transcriptional and translational events.
Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single...
which one of these options is a direct result of:
A single base change in a bacterial gene's -35 TTGACA
consensus sequence
Abnormally short pre-mRNA, with the possibbility of a short but functional A. protein Abnormally long mRNA with the possibility of a short non-functional protein. B. No effect on either transcription or C. translation D. Abnormally long mRNA; may affect transcription and translation of neighboring downstream loci. No direct effect on transcription; mRNA half-life is E. reduced; protein product...
Which one of the options in the picture explains a
direct result to:
Complete elimination of the consensus sequence for 3' cleavage
of a eukaryotic pre-mRNA.
Abnormally short pre-mRNA, with the possibbility of a short but functional A. protein Abnormally long mRNA with the possibility of a short non-functional protein. B. No effect on either transcription or C. translation D. Abnormally long mRNA; may affect transcription and translation of neighboring downstream loci. No direct effect on transcription; mRNA half-life is...
There is a translation error in which a bacterial gene fails to initiate translation. What is one possible problem? A) There were problems in exporting the mRNA out of the nucleus B) There is a mutation at -10/-35 promoter consensus sequence. C) There is a mutation in the Shine-Delgarno sequence D) The 5' Cap is not added so the ribosome cannot find the start codon.
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
17. What sequence allows bacterial ribosomes to identify the CORRECT AUG start codon? A. Ori B. -35 sequence C. TATA box D. poly(A) tail E. Shine-Dalgarno hat name is given to the region of RNA synthesis that contains the DNA, RNA, and RNA polymerase? A. transcriptosome B. transcription complex C. transcription bubble D. replicon E. transcription fork 19. What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100-kd protein?...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
Background Information How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced? Take the DNA sequence below, for example. tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s)...
Hint 1. How is a complete initiation complex formed? Drag the labels to their correct locations in the diagram to describe the roles of the various transcription factors in the formation of a complete initiation complex Reset Help part of initial committed complex TFIIA IIB added during formation of minimal initiation complex sa cosci.ccccccca RNA polymerase II added during formation of complete initiation complex Submit Request Answer Hint 2. How is pre-mRNA processed into mature mRNA? Select the two statements...