Question

Q4) A) Write the complement (also known as inverse complement) of the sequence below indicating its...

Q4)

A) Write the complement (also known as inverse complement) of the sequence below
indicating its directionality-5’-ACGGGCATTAGACATCCACGGAAATTCGCAG


B)Mark the recognition site(s) in this sequence for the restriction enzyme FokI which
recognizes the sequence GGATG

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans 4)

A) Given sequence :    5'-ACGGGCATTAGACATCCACGGAAATTCGCAG-3'

complement sequence : 3'-TGCCCGTAATCTGTAGGTGCCTTTAAGCGTC-5'

B) Recognition site of Fokl is GGATG, so , recognition sites in the complement sequence would be:   

   3'-TGCCCGTAATCTGTAGGTGCCTTTAAGCGTC-5'

Add a comment
Answer #2

A) The complement of a DNA sequence is formed by replacing each base with its complementary base. The complementary bases are as follows: A (adenine) pairs with T (thymine), and C (cytosine) pairs with G (guanine). Additionally, the directionality of the sequence is indicated by the 5' and 3' ends.

Given sequence: 5’- ACGGGCATTAGACATCCACGGAAATTCGCAG -3’

Complement: 3’- TGCCCGTAATCTGTAGGTGCCGTTTAAGCGT -5’

B) The recognition site for the restriction enzyme FokI is "GGATG". To find this site in the given sequence, we need to look for the occurrence of "GGATG".

The sequence contains the recognition site "GGATG" at position 18 to 22 (reading from the 5' end). The sequence "GGATG" is located between the bases C and A in the given sequence.

So, the recognition site for the restriction enzyme FokI in the given sequence is:

5'- ACGGGCATTAGACATCCAGGATGGAAATTCGCAG -3'


answered by: Hydra Master
Add a comment
Know the answer?
Add Answer to:
Q4) A) Write the complement (also known as inverse complement) of the sequence below indicating its...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Write the complement for the DNA sequence below (including directionality). 5’-ATCGGCGTA-3’

    Write the complement for the DNA sequence below (including directionality). 5’-ATCGGCGTA-3’

  • 3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...

    3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...

  • Part B. Please CHOOSE FOUR of the following FIVE questions, indicating clearly which you want to...

    Part B. Please CHOOSE FOUR of the following FIVE questions, indicating clearly which you want to be graded. Do not answer all of them!! (15 points each.) B1. Please consider the restriction enzymes Apal and PspOMI (OMG, who THINKS of these names???). Anyway, these enzymes have the following recognition/cut sequences, with the * indicating the cut site: Apali 5'G GGCC*C 3 3'C *C C G G G 51 PspOMI: 5' G *GG CCC 31 3' C C C G G#...

  • 3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...

    3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...

  • The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E....

    The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E. coli. A restriction map of pFR55 showing the restriction enzyme cutting sites is shown below. The plasmid can replicate I'm E. coli and carries the tetracycline resistance Tc and ampicillin resistance (Ap) genes for use as selectable markers in E. coli. a. you wish to insert a gene into the SalI site of pFR55. How would you select for E. Coli cells that have...

  • 1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

    1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

  • hi I need help with these questions please q1 How long is the DNA sequence encoding...

    hi I need help with these questions please q1 How long is the DNA sequence encoding the protein that confers ampicillin resistance (in bp units)? Input one number only, with no spaces or units. (1 mark) q2 How long is the DNA sequence encoding the protein that confers hygromycin resistance (in bp units)? Input one number only, with no spaces or units. (1 mark) q3 What is the size of the OTC-Δ DNA sequence that has been inserted into the...

  • 1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric...

    1. The figure below shows a DNA double helix and its nucleotide sequence. A. A homodimeric helix–turn–helix protein binds to a DNA fragment containing this sequence. Its preferred half-site is AACAC. Show where the two recognition helices in the protein contact the DNA. B. Are protein–DNA contacts primarily in the major or the minor groove of DNA? What parts of the nucleotides contact the amino acid side chains of the protein to provide most sequence specificity? What kind of bond...

  • Use the given statement to represent a claim. Write its complement and state which is Ho...

    Use the given statement to represent a claim. Write its complement and state which is Ho and which is Ha Hs 203 Find the complement of the claim. Which is Ho and which is H? OA. ????. 203 Ha: ? s 203 O D. Ho: 203 Ha: ? s 203 G. H0?? 203 H.?? z 203 O C. OF, OL ??, B. How$ O E. ??, ?? : ? s 203 ??: ? 203 Ho : ? s 203 He'...

  • please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...

    please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT