What is a transgene vs. a knockout mutation? Which one is likely to use an endogeneous...
What is a transgene vs. a knockout mutation?
Which one is likely to use an endogeneous promoter sequence to drive expression?
Which one can have several (more than 2) copies incorporated?
What is random integration?
Homework Answers
A transgene is an exogenous DNA sequence which is incorporated in the genome of an organism either naturally or artificially.
In knockout mutation, organism genome is modified to inactivate a particular gene function.
Since transgene is an exogenous DNA sequence inserted it will endogenous promoter to drive its expression.
While incorporation a transgene can get incorporated multiple times.
Non-targeted integration a transgene is termed as a random integration.
Add Answer to:
What is a transgene vs. a knockout mutation?
Which one is likely to use an endogeneous...
Which mutation is most likely to have a severe impact on the phenotype of an organism...
Which mutation is most likely to have a severe impact on the phenotype of an organism if it occurs within the first several bases of a gene coding region? A) a frameshift mutation of three nucleotides B) a missense mutation affecting one nucleotide C) a missense mutation affecting three nucleotides D) a silent mutation affecting one nucleotide E) a frameshift mutation of one nucleotide
3) Proto-oncogenes can be converted to oncogenes by various genetic changes. Which of these mechanisms is...
3) Proto-oncogenes can be converted to oncogenes by various genetic changes. Which of these mechanisms is not likely to contribute to conversion to an oncogene? Select one: A: Extra copies of the gene are made, thereby enhancing expression. B: A mutation occurs upstream of the gene that results in a more active promoter. C: Chromosomes break and fragments are translocated from one chromosome to another. D: Point mutations occur that result in a protein more resistant to degradation. E: All...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in...
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35...
2) What is the most likely phenotype of a loss of function mutation in a proto-oncogene?...
2) What is the most likely phenotype of a loss of function mutation in a proto-oncogene? (you may select more than one answer) a) Increased cell division b) decreased cell division c) cancer d) non-disjunction
QUESTION Which one of the following statements is correct? A Anonsense mutation changes a stop codon...
QUESTION Which one of the following statements is correct? A Anonsense mutation changes a stop codon to an amino-acid coding codon B: A nonsense mutation changes an amino-acid codon to a stop codon C: A silent mutation changes the amino acid sequence of the polypeptide D. A missense is usually more severe than a nonsense mutation E A Silent mutation is usually more severe than a missense mutation QUESTIONS "In a plant in which 2n - 24. what is the...
A substitution mutation is one in which one nucleotide base is changed to another
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
Researchers have created every possible "knockout" line in yeast. Each line has exactly one gene deleted...
Researchers have created every possible "knockout" line in yeast. Each line has exactly one gene deleted and all the other genes present (Steinmetz et al. 2002). The growth rate - how fast the number of cells increases per hour - of each of these yeast lines has also been measured, expressed as a multiple of the growth rate of the wild type that has all the genes present. In other words, a growth rate greater than 1 means that a...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Identify u and dv when integrating this expression using integration by parts. 1) u = 2) dv = ( ) dx 3) ∫ ( ) d The integral can be found in more than one way. First use integration by parts, then e...
Identify u and dv when integrating this expression using
integration by parts.
1) u =
2) dv = ( ) dx
3) ∫ ( ) d
The integral can be found in more than one way. First use integration by parts, then expand the expression and integrate the result. -4)x+5 dx
The integral can be found in more than one way. First use integration by parts, then expand the expression and integrate the result. -4)x+5 dx
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35...
QUESTION Which one of the following statements is correct? A Anonsense mutation changes a stop codon to an amino-acid coding codon B: A nonsense mutation changes an amino-acid codon to a stop codon C: A silent mutation changes the amino acid sequence of the polypeptide D. A missense is usually more severe than a nonsense mutation E A Silent mutation is usually more severe than a missense mutation QUESTIONS "In a plant in which 2n - 24. what is the...
Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...
Identify u and dv when integrating this expression using
integration by parts.
1) u =
2) dv = ( ) dx
3) ∫ ( ) d
The integral can be found in more than one way. First use integration by parts, then expand the expression and integrate the result. -4)x+5 dx
The integral can be found in more than one way. First use integration by parts, then expand the expression and integrate the result. -4)x+5 dx
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago