Homework Answers
Add Answer to:
A C TA 4.) What is the RNA transcript given the following DNA Auracil repiaces +hymine...
QUESTION 8 RNA is: O a) transcribed 3 to 5' on the template. b) the same...
QUESTION 8 RNA is: O a) transcribed 3 to 5' on the template. b) the same as the template strand, except using U instead of T. Oc) the same as the nontemplate strand, except using Uinstead of T. d) complementary and antiparallel to the template strand, using G, A, C, and T. O e) complementary and antiparallel to the nontemplate strand.
need help with part c Scie Clas Class DNA to Proteins (Gene Expression) You are given...
need help with part c
Scie Clas Class DNA to Proteins (Gene Expression) You are given the DNA template: 3' A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A-A- T-T-C-TS' Complete the following exercise: A. DNA replication. Write the sequence of complementary bases produced if the above DNA template undergoes replication. 3'A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A- A-T-T-C-T5' 3 T-T-A-T-C-A-T-G-C-G-C-T-C-A-G-C-A-C-t-A-C-T-T- T-A-A-G-AS' B. Transcription. Using the original DNA template, construct the sequence of nucleotide bases for the transcribed RNA strand. 3'AAT-AGT -ACG-CGA-GTC-GTG -ATG-AAA -TTC-T 3'UVA - UCA-UGC-GCU-CAG-CAC-AC - VUU-AAG-A5 C. Translation. Using the mRNA...
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% ,...
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15% a. Is this RNA molecules single stranded or double stranded? How Cant you tell? b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA? 2.) Given the following DNA 5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3' a. What is the transcript (mRNA) sequence? b....
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA...
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X...
1) The following DNA template is transcribed. What is the correct transcript? 3'-GGGTTTTCAGCG-5' 2) Compound X is mutagen is a base analog that can be incorporated opposite either cytosine or thymine during replication. In subsequent rounds of replication, when DNA containing compound X is replicated, it always pairs with thymine. What type of mutation would you expect compound x to cause? a. C : G -> T : A b. T : A -> C : G c. C :...
allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final...
allll pleas
Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
QUESTION 8 RNA is: O a) transcribed 3 to 5' on the template. b) the same as the template strand, except using U instead of T. Oc) the same as the nontemplate strand, except using Uinstead of T. d) complementary and antiparallel to the template strand, using G, A, C, and T. O e) complementary and antiparallel to the nontemplate strand.
need help with part c
Scie Clas Class DNA to Proteins (Gene Expression) You are given the DNA template: 3' A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A-A- T-T-C-TS' Complete the following exercise: A. DNA replication. Write the sequence of complementary bases produced if the above DNA template undergoes replication. 3'A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A- A-T-T-C-T5' 3 T-T-A-T-C-A-T-G-C-G-C-T-C-A-G-C-A-C-t-A-C-T-T- T-A-A-G-AS' B. Transcription. Using the original DNA template, construct the sequence of nucleotide bases for the transcribed RNA strand. 3'AAT-AGT -ACG-CGA-GTC-GTG -ATG-AAA -TTC-T 3'UVA - UCA-UGC-GCU-CAG-CAC-AC - VUU-AAG-A5 C. Translation. Using the mRNA...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2
Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3
If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X
allll pleas
Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago