Question

If the codon changed, its because the nucleotides in the changed. sequence

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANSWER

- If the codon changed, it's because the nucleotides in the DNA / RNA sequence changed.

  • A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.
  • genetic code describes the relationship b/w the sequence of DNA bases (A, C, G, and T) in a gene and the corresponding protein that it encodes
  • A Mutation leads to a change in the CODON of DNA/RNA sequence.
  • a codon is a unit of genetic code.
  • Cells decode mRNAs by reading their codons.
Add a comment
Know the answer?
Add Answer to:
If the codon changed, it's because the nucleotides in the changed. sequence
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5. Fill in the blanks to summarize how change, or a mutation, happens in a cell...

    5. Fill in the blanks to summarize how change, or a mutation, happens in a cell If a doesn't work right, it's probably because it folded wrong. If it folded wrong, it's probably because the changed. of amino acids was If an amino acid changed, it's because the 3- mRNA was changed. codon in the If the codon changed, it's because the nucleotides in the changed. sequence

  • The six nucleotides preceding the start codon and the first nucleotide after the start codon in...

    The six nucleotides preceding the start codon and the first nucleotide after the start codon in eukaryotes exhibit strong sequence preference as determined by the percentages of nucleotides in the -6 to -1 positions and the +4 position. Use the data given in the table to determine the six nucleotides that most commonly precede the start in vertebrates. Express your answer as a sequence of nucleotides separated by dashes. Example: 5'-C-A-T-G-...-3' Use the data given in the table to determine...

  • Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

    Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

  • True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False;...

    True or false: in translation, complimentary nucleotides are matched and converted into amino acid sequence. False; in translation codon nucleotides are bound directly to amino acids False; in translation nucleotides are matched by complementarity but amino acid sequence is unrelated True; codons matching anti-codons is the only process where complimentary nucleotides associate True; nucleotides on mRNA and on tRNA are complimentary (the operon and anti-codon) and the tRNA carries a single amino acid

  • Suppose each of nucleotides A, G, C and T has at the same frequency in a...

    Suppose each of nucleotides A, G, C and T has at the same frequency in a DNA sequence and the nucleotides appear at random. What is the average distance between two stop codons? a. about 5 codon b. about 64 codons c. about 10 codon d, about 21 codon

  • Use the codon sequence below to translate the following mRNA sequence (remember to start with the...

    Use the codon sequence below to translate the following mRNA sequence (remember to start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA   [ Choose ]            methionine            lysine            Stop            tyrosine       1st codon 2nd codon 3rd codon 4th codon 2. Choose terms that are associated with eukaryotic transcription control. Group of answer choices operators transciption factors repressors enhancers

  • 9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what...

    9. Looking at DNA changes more closely, use the If the DNA sequence is TAC, what will the RNA codon be? What amino acid and/or function does this RNA codon code for? What RNA codon(s) code for the amino acid arginine (ARG)? What RNA codon codes for tryptophan (TRP)? What was the DNA sequence that was transcribed to make this codon? (backwards transcribe it) If the last nucleotide (letter) in the TRP codon changes to a "U," will the amino...

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of...

    Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of the sequence changed a codon from a AAA to a UAA then what would be a reasonable prediction 0 The protein coded by his mRNA would be longer O The protein coded by this mRNA would kilthe cell O The protein coded by this mRNA would be the same size O The protein coded by this mRNA would be shorter O The protein coded...

  • 3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mut...

    3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mutated to the sequence 5-UUG-3', what is the expected consequence for the cell? Select all that apply. This change results in a positive mutation. The primary sequence of the protein would not be changed. The primary sequence of the protein would be changed. @ This change results in a silent mutation. This change results in a negative mutation.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT