how many times should a restriction enzyme with a recognition of TCGA cut a DNA sequence of 1000 bases?
a) 2
b)4
c) 8
d) 16
e) 32
The answer is b) 4.
The steps inolved here is,
Step:1: Probability of occurnce of restriction site for TCGA sequence:
As one nitrogen base can occupay in one nucleotide position out of four, the probability of each base is 1/4.
So, the probability of TCGA sequence is 1/4*1/4*1/4*1/4= 1/256.
Step 2: Finding the number of restriction sites for 1000 bases DNA sequence=
No of bases in DNA sequences * probability of restriction site for TCGA sequence
= 1000*1/256 = 3.90 = ~4.
So, the answer is 4.
how many times should a restriction enzyme with a recognition of TCGA cut a DNA sequence...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that molecule will result in how many fragments?
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA