Question

A linear piece of DNA was broken into random, overlapping fraqments and each fragment was then sequenced. The sequence of each fragment is shown below, listed in a random order 5-ATCAAAAGC-3 5-TC 5-GAGGTACCCTTC-3 5-CTATCAAAAGCAT-3 5-AAAAGCATAGAGGTACC-3 5-AAGCATAGAGGTACC-3 TAGAGGTACC-3 af the original fragment placing the sequence that is closest to the 5 end first and moving towards the 3 end. 5 end 5-ATCAAAAGC-3 5-AAAAGCATAGAGGTACC-3 5-TCAAAAGCATAGAGGTACC-3 5-CTATCAAAAGCAT-3 5-GAGGTACCCTTC- 5-AAGCATAGAGGTACC-3 3 and Incorrect You have incorrectly placed the sequence CAAAGCAT. This sequence is the most 5 fragment and should be placed first.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The coding sequence of the original fragment can be determined by observing the overlapping regions and adding the sequences to the 5' end and 3' end.
Realign the sequences in the following order,
5'CTATCAAAA3'
5'ATCAAAAGC3'
5'TCAAAAGCATAGAGGTACC3'
5'AAAAGCATAGGAGGTACC3'
5'AAGCATAGGAGGTAC3'
5'GAGGTACCCTTC3'
hence the coding sequence is
5'CTATCAAAAGCATAGAGGTACCCTTC3'

Add a comment
Know the answer?
Add Answer to:
A linear piece of DNA was broken into random, overlapping fraqments and each fragment was then...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5. If you are digesting a large linear fragment that is 300,000 bp in length. How...

    5. If you are digesting a large linear fragment that is 300,000 bp in length. How many fragments would be produced if the DNA was digested by the following enzymes? Assume the fragment sizes are the average sizes calculated for a random DNA sequence. Use the information in the table from Question 3. Show your work. (A) Smal (B) Haelll (C) Noti Table 4.1 Recognition Sequences and Cutting Sites of Selected Restriction Endonucleases Enzyme Alul BamHI Bgli Clal ECORI Haelll...

  • A linear piece of DNA has the following restrictions sites: You decided to set up an...

    A linear piece of DNA has the following restrictions sites: You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard and is comprised of a series of DNA fragments of known length). a) Which restriction...

  • A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb...

    A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb 4 kb -> 1 kb 2 kb 3 kb You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • 1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and...

    1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...

  • Aliquots of a 7.8-kilobase (kb) linear piece of DNA are digested with the restriction enzymes Pvu...

    Aliquots of a 7.8-kilobase (kb) linear piece of DNA are digested with the restriction enzymes PvuII, HincII, ClaI, and BanII, alone and in pairs. The digestion products are separated by gel electrophoresis, and the size of each fragment is determined by comparison to size standards. The fragment sizes obtained, in kilobase pairs, are given below. Draw a diagram of the 7.8-kb fragment, showing the location of the restriction sites for each enzyme.             a.Digestion with PvuII: 1.3 kb, 6.5 kb             b.Digestion...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Both questions are related to each other, please make sure to answer both. I am struggling...

    Both questions are related to each other, please make sure to answer both. I am struggling to get the concept. 5. Consider the two samples of DNA shown below (single strands are shown for simplicity). If both samples are treated with the restriction enzyme EcoRI (recognition sequence GAATTC) indicate the number of fragments and the size of each fragment from each sample of DNA. Sample #1: 5'CAGTGATCTCGAATTCGCTAGTAACGTT3' Sample #2: 5'TCATGAATTCCTG GAATTCAGATGCCCA 3' Number of fragments List fragments in order of...

  • Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...

    Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...

  • A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...

    A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT