Based on the following DNA sequence: 5’ ATGCGGAGACTTTCCAT… 3’ make an illustration that shows what it...
- Based on the following DNA sequence: 5’ ATGCGGAGACTTTCCAT… 3’ make an illustration that shows what it would look if it contained three additional TCCAT microsats at the 3’ end, Then, make a second illustration to show what it would look like with two minisats of your choosing (remember the difference between a microsat and a minisat).
Homework Answers
Microsatellite DNA is 5 to 50 nucleotides long.
Minisatellite DNA is 10 to 60 nucleotides long.
Addition of micorsatellite -
5' ATGCGGAGACTTTCCATTCCATTCCATTCCAT 3'
Addition of minisatellite (TCGAGTGACGTT)
5' ATGCGGAGACTTTCCATTCGAGTGACGTTTCGAGTGACGTT 3'
Please rate high.
Add Answer to:
Based on the following DNA sequence: 5’
ATGCGGAGACTTTCCAT… 3’ make an
illustration that shows what it...
If a DNA sequence was 5'-AATGCGGATTT-3' in one strand. What would be the sequence in the...
If a DNA sequence was 5'-AATGCGGATTT-3' in one strand. What would be the sequence in the other strand? DNA chains are directional (like polypeptide chains) and anti-parallel. 5' and 3' are references to one end or the other. 5'-AATGCGGATTT-3' 3'-AATGCGGATTT-5' 3'-TTACGCCTAAA-5' 5'-TTACGCCTAAA-3' 3'-TTTAGGCGTAA-5'
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
The following is a strand of DNA. What would be the sequence of the complimentary strand...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
8. Answer the following DNA sequences: Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total...
8. Answer the following DNA sequences: Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of hydrogen bonds between the bases? (Use a numerical answer, no words or units.) Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of phosphodiester bonds? (Use a numerical answer, no words or units.)
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer):
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Give the sequence of the complementary strand of the following DNA of one DNA strand of...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
From what DNA base sequence was the following mRNA sequence transcribed? 5'-UUCGAG-3'
3. The accompanying illustration shows a cast-steel valve body (left) that is machined to the shape...
3. The accompanying illustration shows a cast-steel valve body (left) that is machined to the shape shown on the right. Identify the surfaces that are to be machined. What type of machine tool (Lathe, Drilling Machine, ... etc.) would be suitable to machine this part? What type of machining operations are involved and what is the sequence of these operations (try to present your answer using clear sketches). 20mm -200mm-- Casting After machining 5. The accompanying illustration shows a part...
design a forward and reverse PCR primer based on underlined sequence in the following DNA sequence....
design a forward and reverse PCR primer based on underlined sequence in the following DNA sequence. 3' AAGCCAGGCCCTGGAGT......................TGGACTCGTGGGTGTG.....5' What does "PCR stand for and briefly describe PCR program
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
3. The accompanying illustration shows a cast-steel valve body (left) that is machined to the shape shown on the right. Identify the surfaces that are to be machined. What type of machine tool (Lathe, Drilling Machine, ... etc.) would be suitable to machine this part? What type of machining operations are involved and what is the sequence of these operations (try to present your answer using clear sketches). 20mm -200mm-- Casting After machining 5. The accompanying illustration shows a part...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago