Match the molecular method with its function Increasing or amplifying the amount of DNA through replication...
Homework Answers
Answer :
1) PCR- Is increasing or amplifying the amount of DNA through replication.
Explanation : Polymerase chain reaction is a molecular biology method by which we can prepare millions of copies of a sample DNA rapidly.
2) Restriction enzyme digestion - Cutting DNA into smaller fragments .
Explanation : Restriction digestion of DNA is a process by which we cut DNA into smaller fragments by enzymes called restriction endonucleases.
3) DNA extraction - Isolating DNA from other cellular components .
Explanation : DNA extraction is a procedure used to isolate DNA from nucleus of the cell.
4) Restriction enzyme length polymorphism - Comparing individuals based on their unique nucleotide sequence .
Explanation : Restrictions fragment length polymorphism (RFLP) is a technique that uses variations in DNA sequences (polymorphism ) to distinguish individuals or populations.
Add Answer to:
Match the molecular method with its function
Increasing or amplifying the amount of DNA through
replication...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in...
14. Restriction endonucleases are a. enzymes that restrict DNA synthesis b. enzymes that cut DNA in specific sequences c. nuclear proteins that are involved in transcription d. components of the ribosomes involved in protein synthesis 15. The first step in southern blotting is a. converting DNA into RNA b. cutting high molecular weight DNA into smaller pieces c. converting RNA into DNA d. radioactively labeling the DNA so it can be detected after the procedure is complete 16. The major...
Chapter 10 Review: Biotechnology Learning Objectives and Application Questions Learning objectives are identified for you to...
Chapter 10 Review: Biotechnology Learning Objectives and Application Questions Learning objectives are identified for you to review your understanding of this topic. You are advised to reflect carefully on these objectives and check your own understanding to see if you have understood these essential concepts from this week’s reading. ANSWER THOROUGHLY all the application questions associated with each objective IN YOUR OWN WORDS. Learning Objective I: Evaluate the importance of biotechnology in modern societies (p. 228, 229) Application question #1...
Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
Match each term with its definition. Each term or definition is used only once. Aflatoxin A....
Match each term with its definition. Each term or definition is used only once. Aflatoxin A. The group of Gram-positive bacteria generating lactic acid as the major end product of their fermentive metabolism Anoxic Biotype Bioluminescence B. Taxonomic category of related organisms, usually containing several species; the first name of an organism C. Evolutionary relatedness of organisms D. Isolated from Agrobacterium tumefaciens, it allows those organisms to cause tumors in plants; a derivative in the Binomial System of Nomenclature is...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteina...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
A cell's genome is its blueprint for life. However, what is the bare minimum number of...
A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...
QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into...
QUESTION 1 Although SARS-CoV-2 is currently a global health threat, how might we turn it into a tool for biotechnology? a. It could possibly be turned into a viral vector against lung cancers b. Its promoters might be used to express genes in lung cells c. Its surface proteins could be used for new epitope tags d. All of the above QUESTION 2 Which of the following are applications of molecular assembly described in this course? a. It can be...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
Match each term with its definition. Each term or definition is used only once. Aflatoxin A. The group of Gram-positive bacteria generating lactic acid as the major end product of their fermentive metabolism Anoxic Biotype Bioluminescence B. Taxonomic category of related organisms, usually containing several species; the first name of an organism C. Evolutionary relatedness of organisms D. Isolated from Agrobacterium tumefaciens, it allows those organisms to cause tumors in plants; a derivative in the Binomial System of Nomenclature is...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago