4 Questions below are all connected to each other. PLEASE answer all of them so I can understand...
1. Make up a transmembrane segment sequence (by using one letter amino acid code) of a protein.
-> ITLIYFGVMAGVIGTILLIS <= This is what I made. Is this correct transmembrane segment sequence?
2. Make an amino acid sequence (by using one letter amino acid code) that bind to Bi. <= For this question, you just need to make own amino acid sequence
3. Why would you expect that BiP would not bind to sequence (your made up amino acid sequence from Q2) under “normal circumstances” in cell.
4. Give an example of a situation where BiP would be expected to bind your made-up protein (your made up amino acid sequence from Q2) in cell.

4 Questions below are all connected to each other. PLEASE answer all of them so I...
Please help and do all questions please
Fill in the blanks in the table so as to match the membrande described with the organism having such an membrane: (A) a bacterium living in a compost heap (at a temperature of 50 °C), (B) a (cold blooded) fish living in arctic waters, (C) an oak tree growing in a temperate forest during the spring. and (D) a pathogenic yeast infecting a (warm blooded) mammal (8 points) Fatty Acid Fatty Acid sacrel...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Please note that Questions 15 to 17 are connected
questions.
Question 15:
The following shows a partial DNA sequence from the wild-type
(normal) allele for the human leukemia-linked apoptotic
gene.
5' ATGCGATTAATCGGTAAA 3' (non-template strand)
3' TACGCTAATTAGCCATTT 5' (template strand)
Please answer the following questions:
(a) If the bottom strand serves as the DNA template for
transcription, what is the resulting mRNA sequence?
The mRNA sequence is 5' 3'. (2
marks)
5' AUG CGA UUA AUC GGU AAA 3' ?
Please enter...
1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example: “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...
please help with these. if you answer all of them I'll
be sure to give a thumbs up.
please explain them so I can understand them, especially 28 and 26.
thanks!
13. What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron? 1. A longer than normal mRNA would be produced. 2. A shorter than normal protein would be produced. 3. A longer than normal DNA would be produced....
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
please explain answer to number 4 and 5
NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Song Titles Let's continue with our music analogy by reading a short gene, turning it into mRNA sequence (transcription), and then tuming the mRNA sequence into a protein (translation), which will give us a song title. This will be a small protein, which is often referred to as a "peptide." There are many peptides that are important in biological systems. Some...
tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct Your job now is to copy the above DNA sequence and highlight each of the different sequence elements that are relevant to this particular gene (I suggest that you use different font backgrounds for each sequence element) and briefly explain what each of them do . Then, write the sequence of the mRNA that would be transcribed from this DNA sequence, identifying the AUG and STOP codon (I suggest that you bold and underline text this time). Once you've...