What is the BRCA 1 gene, what is the known function of the encoded protein and...
What is the BRCA 1 gene, what is the known function of the encoded protein and how can you show it performs this function?
Homework Answers
Add Answer to:
What is the BRCA 1 gene, what is the known function of the
encoded protein and...
If it does code for a gene, what is the protein sequence encoded by this DNA...
If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT
For the gene BRCA2, identify the normal function of the protein encoded by the gene and...
For the gene BRCA2, identify the normal function of the protein encoded by the gene and how the mutations of the gene causes Breast cancer via the role of the defective protein in the gene. Diagrams are appreciated to demonstrate the following concepts; 1) Signal Transduction - Is it paracrine signalling? I actually don't understand how the kinases work. 2) Cell Division- It is the S phase right but like I don't know how to phrase it 3) Genetics -...
What is the role of the protein encoded by the lacZ gene? What is the role...
What is the role of the protein
encoded by the lacZ gene?
What is the role of the protein encoded by the lacZ gene? The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene O O O O encodes an enzyme that converts lactose to glucose and galactose. The lacZ gene encodes an enzyme that permits lactose to enter the bacterial cell. The lacZ gene encodes an enzyme that converts lactose to glucose and galactose....
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of...
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...
Please explain in details Using the ActiveModel for Brca2 (the protein encoded by the BRCA2 gene...
Please explain in details
Using the ActiveModel for Brca2 (the protein encoded by the BRCA2 gene associated with breast cancer susceptibility), discuss how a mutation in a BRC motif could cause breast cancer.
An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant...
An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant mutation in gene A over accumulate substrate X, which causes severe neurological symptoms. At the molecular level, this enzyme functions as a homodimer. A homodimer is a protein composed of two subunits that are encoded by the same gene. Let’s suppose you are able to purify subunits from cell samples and then mix them together under conditions in which they form homodimers, and you...
Human protein X is encoded by human gene X. Gene X consists of 4 exons of...
Human protein X is encoded by human gene X. Gene X consists of 4 exons of 200 bp each, interspersed with introns of 1,000 bp each. An mRNA cap will be found on ____________. (Pick all that apply.) the primary transcript the mRNA at least one of the lariats the poly(A) tail. exon 1 all exons some introns
A geneticist discovers that two different proteins are encoded by the same gene. One protein has...
A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. Which of the statements are possible explanations for how the same gene can encode both of these proteins? 1-The same gene encodes both proteins by using different combinations of introns in the pre‑mRNA via alternative splicing. 2-The same gene encodes both proteins by generating a poly(A) tail on the pre‑mRNA. 3-The same gene encodes...
It is known that Gene C encodes a protein that binds to the transcription promoter of...
It is known that Gene C encodes a protein that binds to the transcription promoter of gene D, and the expression of Gene D leads to wing elongation.Based on the information provided above, propose a possible function of gene C that can explain the difference in body features of original insects and long-wing mutant insects.
In a wild-type carnivorous plant, protein X is encoded by a haplosufficient gene “X”. The X...
In a wild-type carnivorous plant, protein X is encoded by a haplosufficient gene “X”. The X protein normally homodimerizes. The X-X dimer enzymatically catalyzes a biochemical reaction that is critical for the digestion of insects that it traps. XD represents a dominant negative allele, a mutation, of gene X. What would be the predicted phenotype of a plant with the genotype X+/XD ? Which one of these pieces of information allows you to reach that conclusion? a. The plant would...
What is the role of the protein
encoded by the lacZ gene?
What is the role of the protein encoded by the lacZ gene? The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene O O O O encodes an enzyme that converts lactose to glucose and galactose. The lacZ gene encodes an enzyme that permits lactose to enter the bacterial cell. The lacZ gene encodes an enzyme that converts lactose to glucose and galactose....
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...
Please explain in details
Using the ActiveModel for Brca2 (the protein encoded by the BRCA2 gene associated with breast cancer susceptibility), discuss how a mutation in a BRC motif could cause breast cancer.
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago