HomeworkLib
Question

.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the...

.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the region of the RNA polymerase initiation site.

AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

The -10 region hexanucleotide sequence is TTGGGATCCC

AACCCUAGGG   

it is site before the intiation site and is given - sign

TATAAT is the region where RNA polymerase initation begins.

RNA polymerase are enzymes that helps in the transcription of DNA into RNA. It uses DNA template for synthesis of RNA molecule. In the process of trancription thymine is replaced by uracil molecule and initate the process.  TATAAT these are the promoter regions where the process begins followed by elongation and termination.

0 0
Add a comment
Know the answer?
Add Answer to:
.  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • The process of DNA transcription: produces single stranded RNA complementary to the coding strand. requires RNA...

    The process of DNA transcription: produces single stranded RNA complementary to the coding strand. requires RNA polymerase. is discontinuous. produces double stranded DNA. requires DNA polymerase III. Among the significant sites that many eukaryotic promoters contain is: a TATAAT box near –10. a TATA site near –30 to –100. a CATA site at the transcription start site. a Pribnow box. the Shine-Dalgarno sequence.

  • region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA...

    region is a DNA sequence that regulates transcription. Within a gene, a region is a DNA sequence that encodes RNA and a o coding, barcoding o control, coding o noncoding, control o coding, control During transcription, the DNA template is read in the ___direction. o 3 to 5 oC to N terminal ON to C terminal 0 5' to 3' For genes encoding protein, which of the following is the eukaryotic consensus sequence of the promoter? ATAT o GCGC CGCG...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - CCTAAGGGTTAA - 3' 3' - GGATTCCCAATT - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? 5' - UUAACCCUUAGG - 3' This is the answer, can someone explain how you get this answer.

  • You are told that in the DNA sequence below the bottom strand is the coding strand....

    You are told that in the DNA sequence below the bottom strand is the coding strand. 5' - ATGTTTAGCGCC - 3' 3' - TACAAATCGCGG - 5' If this sequence were to be transcribed, what would the sequence of the messenger RNA be? a 3' - GGCGCUAAACAU - 5' b 5' - CCGCGAUUUCUA - 3' c 3' - CCGCGAUUUCUA - 5' d 5' - GGCGCUAAACAU - 3'

  • 2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...

    2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.

  • If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...

    If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X

  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

  • Please fill in the Blank: _______ is the single stranded region formed (later forms DNA-RNA hybrid)...

    Please fill in the Blank: _______ is the single stranded region formed (later forms DNA-RNA hybrid) as RNA polymerase moves along the DNA during the transcription process. Possible terms: exon, anticodon, spliceosomes, introns, coding strand, N site, P site, A site, transcription bubble, promoter, gamma factor, helioterminating factor, rho factor, degeneracy, diasteriomers,   

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT