Question

The bacterial holoenzyme binds a. only to the template strand b. only to the non-template strand...

The bacterial holoenzyme binds

a. only to the template strand

b. only to the non-template strand

c. to both strands

0 0
Add a comment Improve this question Transcribed image text
Answer #1

to both strands.

because the holoenzyme is the part of RNA polymerase. It binds to the -10 to -20 consensus sequence in the DNA and leads to unwinding the double stranded DNA. In this way, it creates a bubble formation which provides the appropriate place for the activity of RNA polymerase to synthesise the RNA by the process of transcription.

Add a comment
Know the answer?
Add Answer to:
The bacterial holoenzyme binds a. only to the template strand b. only to the non-template strand...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If the template strand for replication (the DNA strand that the DNA polymerase binds to and...

    If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?

  • 1) The DNA template is read in the ______ direction, and the new strand is synthesized...

    1) The DNA template is read in the ______ direction, and the new strand is synthesized in the ____ direction. A) 5' to 3' ; 3' to 5' B) 5' to 3' ; 5' to 3' C) 3' to 5' ; 5' to 3' D) 3' to 5' ; 3' to 5' 2) If a sequence of DNA is 5' AATTGCCGT 3', the complementary strand would be A) 3' AAAACGCCA 5' B) 3' TTAACGGCT 5' C) 5' ACGGCAATT 3' D)...

  • The lagging strand in DNA replication?: (A) is synthesized after the leading strand. (B) causes the...

    The lagging strand in DNA replication?: (A) is synthesized after the leading strand. (B) causes the formation of Okazaki fragments in the leading strand. (C) is a consequence of replicating both strands of template DNA at a single replication fork. (D) requires its own replisome.

  • RNA polymerase binds to DNA after the double strands have been unwound by helicase. binds to...

    RNA polymerase binds to DNA after the double strands have been unwound by helicase. binds to the promoter region and synthesizes mRNA in a 3' to 5' direction. binds to the template strand in the promoter region. transcribes the poly A tail.

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • 2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...

    2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.

  • The three rows of boxes on this diagram represent a continuous strand of non-template DNA of...

    The three rows of boxes on this diagram represent a continuous strand of non-template DNA of E. coli. Identify the location of the promoter region in the DNA sequence on the diagram. (1) Locate and describe the function of the two conserved DNA sequences within the promoter region. (2) Indicate the approximate location on the diagram where transcription will start and begin “synthesizing” mRNA at that point. (1) Identify the location sequence on the diagram that will terminate transcription and...

  • Note that one of the two halves of the DNA molecule is labeled template strand and...

    Note that one of the two halves of the DNA molecule is labeled template strand and the other is the non-template strand. In protein synthesis, the RNA polymerase reads the template strand and uses it to make mRNA, filling in complementary bases. The mRNA then closely resembles the non-template strand. a. In what two significant ways do the non-template strand and the mRNA differ?

  • For each statement, choose which strand, if any, fits the description of the diagram relative to...

    For each statement, choose which strand, if any, fits the description of the diagram relative to the right side of the origin of replication. 1- Producing an identical copy of this strand involves a single primer molecule.................   ["neither strand", "strand A", "strand B", or "both strands"]       2- Producing an identical copy of this strand involves multiple primer molecules................. ["neither strand", "strand B", "both strands", or "strand A"]       3- This is the template for the leading strand...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT